ID: 1198483126

View in Genome Browser
Species Human (GRCh38)
Location X:137059168-137059190
Sequence GAGCTTCCTCACTGGCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198483123_1198483126 24 Left 1198483123 X:137059121-137059143 CCAGAGTTGTTTTTTTTTTGTTT No data
Right 1198483126 X:137059168-137059190 GAGCTTCCTCACTGGCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198483126 Original CRISPR GAGCTTCCTCACTGGCACAA AGG Intergenic
No off target data available for this crispr