ID: 1198487848

View in Genome Browser
Species Human (GRCh38)
Location X:137106312-137106334
Sequence CAGTACATGCACTAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198487842_1198487848 18 Left 1198487842 X:137106271-137106293 CCTTTGCTGTATTCTGTTGATTA No data
Right 1198487848 X:137106312-137106334 CAGTACATGCACTAGGAGGCAGG No data
1198487841_1198487848 25 Left 1198487841 X:137106264-137106286 CCTATTTCCTTTGCTGTATTCTG No data
Right 1198487848 X:137106312-137106334 CAGTACATGCACTAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198487848 Original CRISPR CAGTACATGCACTAGGAGGC AGG Intergenic
No off target data available for this crispr