ID: 1198492919

View in Genome Browser
Species Human (GRCh38)
Location X:137161512-137161534
Sequence TCACTTCTGTTTACGTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198492918_1198492919 9 Left 1198492918 X:137161480-137161502 CCTTCAAGGGCATAAACTGGAAA No data
Right 1198492919 X:137161512-137161534 TCACTTCTGTTTACGTCCAGTGG No data
1198492915_1198492919 14 Left 1198492915 X:137161475-137161497 CCTTCCCTTCAAGGGCATAAACT No data
Right 1198492919 X:137161512-137161534 TCACTTCTGTTTACGTCCAGTGG No data
1198492917_1198492919 10 Left 1198492917 X:137161479-137161501 CCCTTCAAGGGCATAAACTGGAA No data
Right 1198492919 X:137161512-137161534 TCACTTCTGTTTACGTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198492919 Original CRISPR TCACTTCTGTTTACGTCCAG TGG Intergenic
No off target data available for this crispr