ID: 1198493447

View in Genome Browser
Species Human (GRCh38)
Location X:137166756-137166778
Sequence CCAGTTAGGCCCCCTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198493447_1198493452 -9 Left 1198493447 X:137166756-137166778 CCAGTGAGAGGGGGCCTAACTGG No data
Right 1198493452 X:137166770-137166792 CCTAACTGGGTCAGCCACTAGGG No data
1198493447_1198493453 -8 Left 1198493447 X:137166756-137166778 CCAGTGAGAGGGGGCCTAACTGG No data
Right 1198493453 X:137166771-137166793 CTAACTGGGTCAGCCACTAGGGG No data
1198493447_1198493458 18 Left 1198493447 X:137166756-137166778 CCAGTGAGAGGGGGCCTAACTGG No data
Right 1198493458 X:137166797-137166819 TGTGAGTACGGGTCTGCAACTGG No data
1198493447_1198493457 7 Left 1198493447 X:137166756-137166778 CCAGTGAGAGGGGGCCTAACTGG No data
Right 1198493457 X:137166786-137166808 ACTAGGGGGCATGTGAGTACGGG No data
1198493447_1198493456 6 Left 1198493447 X:137166756-137166778 CCAGTGAGAGGGGGCCTAACTGG No data
Right 1198493456 X:137166785-137166807 CACTAGGGGGCATGTGAGTACGG No data
1198493447_1198493460 26 Left 1198493447 X:137166756-137166778 CCAGTGAGAGGGGGCCTAACTGG No data
Right 1198493460 X:137166805-137166827 CGGGTCTGCAACTGGGAAAGAGG No data
1198493447_1198493459 19 Left 1198493447 X:137166756-137166778 CCAGTGAGAGGGGGCCTAACTGG No data
Right 1198493459 X:137166798-137166820 GTGAGTACGGGTCTGCAACTGGG No data
1198493447_1198493454 -7 Left 1198493447 X:137166756-137166778 CCAGTGAGAGGGGGCCTAACTGG No data
Right 1198493454 X:137166772-137166794 TAACTGGGTCAGCCACTAGGGGG No data
1198493447_1198493450 -10 Left 1198493447 X:137166756-137166778 CCAGTGAGAGGGGGCCTAACTGG No data
Right 1198493450 X:137166769-137166791 GCCTAACTGGGTCAGCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198493447 Original CRISPR CCAGTTAGGCCCCCTCTCAC TGG (reversed) Intergenic
No off target data available for this crispr