ID: 1198498521

View in Genome Browser
Species Human (GRCh38)
Location X:137218747-137218769
Sequence ATGTCCTTTTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198498521_1198498523 18 Left 1198498521 X:137218747-137218769 CCTTCACTCTTCTAAAAGGACAT No data
Right 1198498523 X:137218788-137218810 TCCATGATTTAGAAAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198498521 Original CRISPR ATGTCCTTTTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr