ID: 1198498523

View in Genome Browser
Species Human (GRCh38)
Location X:137218788-137218810
Sequence TCCATGATTTAGAAAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198498519_1198498523 26 Left 1198498519 X:137218739-137218761 CCAGGAGGCCTTCACTCTTCTAA No data
Right 1198498523 X:137218788-137218810 TCCATGATTTAGAAAAAAAGAGG No data
1198498521_1198498523 18 Left 1198498521 X:137218747-137218769 CCTTCACTCTTCTAAAAGGACAT No data
Right 1198498523 X:137218788-137218810 TCCATGATTTAGAAAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198498523 Original CRISPR TCCATGATTTAGAAAAAAAG AGG Intergenic
No off target data available for this crispr