ID: 1198502291

View in Genome Browser
Species Human (GRCh38)
Location X:137263305-137263327
Sequence CTGTAGGAATGGAAAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198502287_1198502291 8 Left 1198502287 X:137263274-137263296 CCATTTATACGATATTATGGAAA No data
Right 1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198502291 Original CRISPR CTGTAGGAATGGAAAGAAAT TGG Intergenic
No off target data available for this crispr