ID: 1198504372

View in Genome Browser
Species Human (GRCh38)
Location X:137286887-137286909
Sequence AAGGGATCAGAAATGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198504372_1198504375 -10 Left 1198504372 X:137286887-137286909 CCTTCCCTCATTTCTGATCCCTT No data
Right 1198504375 X:137286900-137286922 CTGATCCCTTAACCCTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198504372 Original CRISPR AAGGGATCAGAAATGAGGGA AGG (reversed) Intergenic
No off target data available for this crispr