ID: 1198504741

View in Genome Browser
Species Human (GRCh38)
Location X:137290336-137290358
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198504732_1198504741 15 Left 1198504732 X:137290298-137290320 CCAGAGAAGCGGAATTGTTGAAT No data
Right 1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198504741 Original CRISPR CTGTAAAAGGAAATGGAGGA GGG Intergenic
No off target data available for this crispr