ID: 1198508760 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:137328046-137328068 |
Sequence | CTCAGGAAGGGGAAATATGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1198508760_1198508765 | -10 | Left | 1198508760 | X:137328046-137328068 | CCACCATATTTCCCCTTCCTGAG | No data | ||
Right | 1198508765 | X:137328059-137328081 | CCTTCCTGAGCACCCACACCAGG | No data | ||||
1198508760_1198508770 | 17 | Left | 1198508760 | X:137328046-137328068 | CCACCATATTTCCCCTTCCTGAG | No data | ||
Right | 1198508770 | X:137328086-137328108 | GTCCATTTCCCAGTCTCTCTTGG | No data | ||||
1198508760_1198508772 | 20 | Left | 1198508760 | X:137328046-137328068 | CCACCATATTTCCCCTTCCTGAG | No data | ||
Right | 1198508772 | X:137328089-137328111 | CATTTCCCAGTCTCTCTTGGAGG | No data | ||||
1198508760_1198508773 | 21 | Left | 1198508760 | X:137328046-137328068 | CCACCATATTTCCCCTTCCTGAG | No data | ||
Right | 1198508773 | X:137328090-137328112 | ATTTCCCAGTCTCTCTTGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1198508760 | Original CRISPR | CTCAGGAAGGGGAAATATGG TGG (reversed) | Intergenic | ||
No off target data available for this crispr |