ID: 1198508760

View in Genome Browser
Species Human (GRCh38)
Location X:137328046-137328068
Sequence CTCAGGAAGGGGAAATATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198508760_1198508765 -10 Left 1198508760 X:137328046-137328068 CCACCATATTTCCCCTTCCTGAG No data
Right 1198508765 X:137328059-137328081 CCTTCCTGAGCACCCACACCAGG No data
1198508760_1198508770 17 Left 1198508760 X:137328046-137328068 CCACCATATTTCCCCTTCCTGAG No data
Right 1198508770 X:137328086-137328108 GTCCATTTCCCAGTCTCTCTTGG No data
1198508760_1198508772 20 Left 1198508760 X:137328046-137328068 CCACCATATTTCCCCTTCCTGAG No data
Right 1198508772 X:137328089-137328111 CATTTCCCAGTCTCTCTTGGAGG No data
1198508760_1198508773 21 Left 1198508760 X:137328046-137328068 CCACCATATTTCCCCTTCCTGAG No data
Right 1198508773 X:137328090-137328112 ATTTCCCAGTCTCTCTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198508760 Original CRISPR CTCAGGAAGGGGAAATATGG TGG (reversed) Intergenic
No off target data available for this crispr