ID: 1198510331

View in Genome Browser
Species Human (GRCh38)
Location X:137344020-137344042
Sequence TGGTAGAATTGTCATTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198510331_1198510339 22 Left 1198510331 X:137344020-137344042 CCAACCCAATGACAATTCTACCA No data
Right 1198510339 X:137344065-137344087 AACAAAAAGTGATTTTGAATTGG No data
1198510331_1198510340 30 Left 1198510331 X:137344020-137344042 CCAACCCAATGACAATTCTACCA No data
Right 1198510340 X:137344073-137344095 GTGATTTTGAATTGGATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198510331 Original CRISPR TGGTAGAATTGTCATTGGGT TGG (reversed) Intergenic
No off target data available for this crispr