ID: 1198511730

View in Genome Browser
Species Human (GRCh38)
Location X:137358823-137358845
Sequence ATGAAGATGGAGAAGTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198511730_1198511734 20 Left 1198511730 X:137358823-137358845 CCTGGCTACTTCTCCATCTTCAT No data
Right 1198511734 X:137358866-137358888 ACTCTGCATCACAACGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198511730 Original CRISPR ATGAAGATGGAGAAGTAGCC AGG (reversed) Intergenic
No off target data available for this crispr