ID: 1198512051

View in Genome Browser
Species Human (GRCh38)
Location X:137361937-137361959
Sequence GTACAGCTATACCACAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198512042_1198512051 30 Left 1198512042 X:137361884-137361906 CCTCTGACTCCACAGTGCATGGA No data
Right 1198512051 X:137361937-137361959 GTACAGCTATACCACAGTGTTGG No data
1198512043_1198512051 21 Left 1198512043 X:137361893-137361915 CCACAGTGCATGGATTTCACAAT No data
Right 1198512051 X:137361937-137361959 GTACAGCTATACCACAGTGTTGG No data
1198512046_1198512051 -7 Left 1198512046 X:137361921-137361943 CCCTCTCCCCTGCTTGGTACAGC No data
Right 1198512051 X:137361937-137361959 GTACAGCTATACCACAGTGTTGG No data
1198512047_1198512051 -8 Left 1198512047 X:137361922-137361944 CCTCTCCCCTGCTTGGTACAGCT No data
Right 1198512051 X:137361937-137361959 GTACAGCTATACCACAGTGTTGG No data
1198512045_1198512051 -6 Left 1198512045 X:137361920-137361942 CCCCTCTCCCCTGCTTGGTACAG No data
Right 1198512051 X:137361937-137361959 GTACAGCTATACCACAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198512051 Original CRISPR GTACAGCTATACCACAGTGT TGG Intergenic
No off target data available for this crispr