ID: 1198512857

View in Genome Browser
Species Human (GRCh38)
Location X:137371670-137371692
Sequence CAGGAGAACGTGAAGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198512853_1198512857 -6 Left 1198512853 X:137371653-137371675 CCAAATAAAAGAGAAGCCAGGAG No data
Right 1198512857 X:137371670-137371692 CAGGAGAACGTGAAGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198512857 Original CRISPR CAGGAGAACGTGAAGTTTTG GGG Intergenic
No off target data available for this crispr