ID: 1198515430

View in Genome Browser
Species Human (GRCh38)
Location X:137401769-137401791
Sequence CCAGTTTACCAGTACTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198515430_1198515437 17 Left 1198515430 X:137401769-137401791 CCAGTGGAGTACTGGTAAACTGG No data
Right 1198515437 X:137401809-137401831 CCCTGATTTGCCAGTTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198515430 Original CRISPR CCAGTTTACCAGTACTCCAC TGG (reversed) Intergenic
No off target data available for this crispr