ID: 1198520303

View in Genome Browser
Species Human (GRCh38)
Location X:137445730-137445752
Sequence CCAGACCTGGCACTGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198520303_1198520309 3 Left 1198520303 X:137445730-137445752 CCAGCACACAGTGCCAGGTCTGG No data
Right 1198520309 X:137445756-137445778 ATGGCTGGCACTCAAAGTTTTGG No data
1198520303_1198520310 22 Left 1198520303 X:137445730-137445752 CCAGCACACAGTGCCAGGTCTGG No data
Right 1198520310 X:137445775-137445797 TTGGAACTGAACTGTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198520303 Original CRISPR CCAGACCTGGCACTGTGTGC TGG (reversed) Intergenic
No off target data available for this crispr