ID: 1198524441

View in Genome Browser
Species Human (GRCh38)
Location X:137486453-137486475
Sequence GTAGATACACAGATTTATTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198524441_1198524444 19 Left 1198524441 X:137486453-137486475 CCGAAATAAATCTGTGTATCTAC No data
Right 1198524444 X:137486495-137486517 AAAGTGCAAAGAACATACAATGG No data
1198524441_1198524446 21 Left 1198524441 X:137486453-137486475 CCGAAATAAATCTGTGTATCTAC No data
Right 1198524446 X:137486497-137486519 AGTGCAAAGAACATACAATGGGG No data
1198524441_1198524445 20 Left 1198524441 X:137486453-137486475 CCGAAATAAATCTGTGTATCTAC No data
Right 1198524445 X:137486496-137486518 AAGTGCAAAGAACATACAATGGG No data
1198524441_1198524442 -6 Left 1198524441 X:137486453-137486475 CCGAAATAAATCTGTGTATCTAC No data
Right 1198524442 X:137486470-137486492 ATCTACAGTCAATTGATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198524441 Original CRISPR GTAGATACACAGATTTATTT CGG (reversed) Intergenic
No off target data available for this crispr