ID: 1198524862

View in Genome Browser
Species Human (GRCh38)
Location X:137490981-137491003
Sequence GGGGGGATACAGAAGAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198524862_1198524872 11 Left 1198524862 X:137490981-137491003 CCTTGCCTCTTCTGTATCCCCCC No data
Right 1198524872 X:137491015-137491037 GATTGAGTTGGGCACTGTAATGG No data
1198524862_1198524873 12 Left 1198524862 X:137490981-137491003 CCTTGCCTCTTCTGTATCCCCCC No data
Right 1198524873 X:137491016-137491038 ATTGAGTTGGGCACTGTAATGGG No data
1198524862_1198524871 0 Left 1198524862 X:137490981-137491003 CCTTGCCTCTTCTGTATCCCCCC No data
Right 1198524871 X:137491004-137491026 ACAATACAGAGGATTGAGTTGGG No data
1198524862_1198524870 -1 Left 1198524862 X:137490981-137491003 CCTTGCCTCTTCTGTATCCCCCC No data
Right 1198524870 X:137491003-137491025 CACAATACAGAGGATTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198524862 Original CRISPR GGGGGGATACAGAAGAGGCA AGG (reversed) Intergenic
No off target data available for this crispr