ID: 1198526331

View in Genome Browser
Species Human (GRCh38)
Location X:137504962-137504984
Sequence TAGGATCCTGGATCAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198526331_1198526337 29 Left 1198526331 X:137504962-137504984 CCAGGCCCTGATCCAGGATCCTA No data
Right 1198526337 X:137505014-137505036 TCCAATATGTAACAATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198526331 Original CRISPR TAGGATCCTGGATCAGGGCC TGG (reversed) Intergenic
No off target data available for this crispr