ID: 1198528003

View in Genome Browser
Species Human (GRCh38)
Location X:137521595-137521617
Sequence CCGTGGACACCATTATCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198527999_1198528003 -4 Left 1198527999 X:137521576-137521598 CCTTGCTACATTCCATGATCCGT No data
Right 1198528003 X:137521595-137521617 CCGTGGACACCATTATCTCCTGG No data
1198527998_1198528003 19 Left 1198527998 X:137521553-137521575 CCACATACTGCAGAAGCAAGAGA No data
Right 1198528003 X:137521595-137521617 CCGTGGACACCATTATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198528003 Original CRISPR CCGTGGACACCATTATCTCC TGG Intergenic
No off target data available for this crispr