ID: 1198530738

View in Genome Browser
Species Human (GRCh38)
Location X:137548285-137548307
Sequence CTCGCCGGTATCTCCGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198530738_1198530745 -7 Left 1198530738 X:137548285-137548307 CCTTCCCCGGAGATACCGGCGAG No data
Right 1198530745 X:137548301-137548323 CGGCGAGTCTCGGGTGCACCAGG No data
1198530738_1198530752 26 Left 1198530738 X:137548285-137548307 CCTTCCCCGGAGATACCGGCGAG No data
Right 1198530752 X:137548334-137548356 TTTTCTCCTTACTGGGATTGGGG No data
1198530738_1198530748 18 Left 1198530738 X:137548285-137548307 CCTTCCCCGGAGATACCGGCGAG No data
Right 1198530748 X:137548326-137548348 GGAGCAAGTTTTCTCCTTACTGG No data
1198530738_1198530750 24 Left 1198530738 X:137548285-137548307 CCTTCCCCGGAGATACCGGCGAG No data
Right 1198530750 X:137548332-137548354 AGTTTTCTCCTTACTGGGATTGG No data
1198530738_1198530749 19 Left 1198530738 X:137548285-137548307 CCTTCCCCGGAGATACCGGCGAG No data
Right 1198530749 X:137548327-137548349 GAGCAAGTTTTCTCCTTACTGGG No data
1198530738_1198530751 25 Left 1198530738 X:137548285-137548307 CCTTCCCCGGAGATACCGGCGAG No data
Right 1198530751 X:137548333-137548355 GTTTTCTCCTTACTGGGATTGGG No data
1198530738_1198530746 -3 Left 1198530738 X:137548285-137548307 CCTTCCCCGGAGATACCGGCGAG No data
Right 1198530746 X:137548305-137548327 GAGTCTCGGGTGCACCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198530738 Original CRISPR CTCGCCGGTATCTCCGGGGA AGG (reversed) Intergenic
No off target data available for this crispr