ID: 1198531892

View in Genome Browser
Species Human (GRCh38)
Location X:137556004-137556026
Sequence ACCTCCTTCTAGAAGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198531892_1198531896 2 Left 1198531892 X:137556004-137556026 CCTTCTTTCTTCTAGAAGGAGGT No data
Right 1198531896 X:137556029-137556051 GGAGTGGATCTGTTGAAAACGGG No data
1198531892_1198531897 3 Left 1198531892 X:137556004-137556026 CCTTCTTTCTTCTAGAAGGAGGT No data
Right 1198531897 X:137556030-137556052 GAGTGGATCTGTTGAAAACGGGG No data
1198531892_1198531895 1 Left 1198531892 X:137556004-137556026 CCTTCTTTCTTCTAGAAGGAGGT No data
Right 1198531895 X:137556028-137556050 AGGAGTGGATCTGTTGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198531892 Original CRISPR ACCTCCTTCTAGAAGAAAGA AGG (reversed) Intergenic
No off target data available for this crispr