ID: 1198531895

View in Genome Browser
Species Human (GRCh38)
Location X:137556028-137556050
Sequence AGGAGTGGATCTGTTGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198531892_1198531895 1 Left 1198531892 X:137556004-137556026 CCTTCTTTCTTCTAGAAGGAGGT No data
Right 1198531895 X:137556028-137556050 AGGAGTGGATCTGTTGAAAACGG No data
1198531887_1198531895 8 Left 1198531887 X:137555997-137556019 CCACTCCCCTTCTTTCTTCTAGA No data
Right 1198531895 X:137556028-137556050 AGGAGTGGATCTGTTGAAAACGG No data
1198531890_1198531895 2 Left 1198531890 X:137556003-137556025 CCCTTCTTTCTTCTAGAAGGAGG No data
Right 1198531895 X:137556028-137556050 AGGAGTGGATCTGTTGAAAACGG No data
1198531886_1198531895 16 Left 1198531886 X:137555989-137556011 CCGAATCTCCACTCCCCTTCTTT No data
Right 1198531895 X:137556028-137556050 AGGAGTGGATCTGTTGAAAACGG No data
1198531889_1198531895 3 Left 1198531889 X:137556002-137556024 CCCCTTCTTTCTTCTAGAAGGAG No data
Right 1198531895 X:137556028-137556050 AGGAGTGGATCTGTTGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198531895 Original CRISPR AGGAGTGGATCTGTTGAAAA CGG Intergenic
No off target data available for this crispr