ID: 1198536967

View in Genome Browser
Species Human (GRCh38)
Location X:137595890-137595912
Sequence TTATTTTACCAGTGCTCCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198536963_1198536967 1 Left 1198536963 X:137595866-137595888 CCCATTGTATGGCTGTACCATCC No data
Right 1198536967 X:137595890-137595912 TTATTTTACCAGTGCTCCATCGG No data
1198536964_1198536967 0 Left 1198536964 X:137595867-137595889 CCATTGTATGGCTGTACCATCCT No data
Right 1198536967 X:137595890-137595912 TTATTTTACCAGTGCTCCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198536967 Original CRISPR TTATTTTACCAGTGCTCCAT CGG Intergenic
No off target data available for this crispr