ID: 1198556622

View in Genome Browser
Species Human (GRCh38)
Location X:137799998-137800020
Sequence GGGTATTGCTGGCACCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198556622_1198556630 15 Left 1198556622 X:137799998-137800020 CCCACTAGGTGCCAGCAATACCC No data
Right 1198556630 X:137800036-137800058 CATTGCAAAATGTCCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198556622 Original CRISPR GGGTATTGCTGGCACCTAGT GGG (reversed) Intergenic