ID: 1198556626

View in Genome Browser
Species Human (GRCh38)
Location X:137800019-137800041
Sequence GCAATGTCTGGAGATGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198556626_1198556634 25 Left 1198556626 X:137800019-137800041 CCTCCTCCATCTCCAGACATTGC No data
Right 1198556634 X:137800067-137800089 CACCCTGACTGAGAACCACTGGG No data
1198556626_1198556630 -6 Left 1198556626 X:137800019-137800041 CCTCCTCCATCTCCAGACATTGC No data
Right 1198556630 X:137800036-137800058 CATTGCAAAATGTCCTCTGCAGG No data
1198556626_1198556633 24 Left 1198556626 X:137800019-137800041 CCTCCTCCATCTCCAGACATTGC No data
Right 1198556633 X:137800066-137800088 TCACCCTGACTGAGAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198556626 Original CRISPR GCAATGTCTGGAGATGGAGG AGG (reversed) Intergenic