ID: 1198556630

View in Genome Browser
Species Human (GRCh38)
Location X:137800036-137800058
Sequence CATTGCAAAATGTCCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198556622_1198556630 15 Left 1198556622 X:137799998-137800020 CCCACTAGGTGCCAGCAATACCC No data
Right 1198556630 X:137800036-137800058 CATTGCAAAATGTCCTCTGCAGG No data
1198556625_1198556630 -5 Left 1198556625 X:137800018-137800040 CCCTCCTCCATCTCCAGACATTG No data
Right 1198556630 X:137800036-137800058 CATTGCAAAATGTCCTCTGCAGG No data
1198556627_1198556630 -9 Left 1198556627 X:137800022-137800044 CCTCCATCTCCAGACATTGCAAA No data
Right 1198556630 X:137800036-137800058 CATTGCAAAATGTCCTCTGCAGG No data
1198556621_1198556630 21 Left 1198556621 X:137799992-137800014 CCTCTACCCACTAGGTGCCAGCA No data
Right 1198556630 X:137800036-137800058 CATTGCAAAATGTCCTCTGCAGG No data
1198556624_1198556630 4 Left 1198556624 X:137800009-137800031 CCAGCAATACCCTCCTCCATCTC No data
Right 1198556630 X:137800036-137800058 CATTGCAAAATGTCCTCTGCAGG No data
1198556623_1198556630 14 Left 1198556623 X:137799999-137800021 CCACTAGGTGCCAGCAATACCCT No data
Right 1198556630 X:137800036-137800058 CATTGCAAAATGTCCTCTGCAGG No data
1198556626_1198556630 -6 Left 1198556626 X:137800019-137800041 CCTCCTCCATCTCCAGACATTGC No data
Right 1198556630 X:137800036-137800058 CATTGCAAAATGTCCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198556630 Original CRISPR CATTGCAAAATGTCCTCTGC AGG Intergenic
No off target data available for this crispr