ID: 1198556670

View in Genome Browser
Species Human (GRCh38)
Location X:137800782-137800804
Sequence TGATGCAGTTAGGGTTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198556670_1198556675 4 Left 1198556670 X:137800782-137800804 CCAAGCTAACCCTAACTGCATCA No data
Right 1198556675 X:137800809-137800831 TAGGGCCAAATTTATGTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198556670 Original CRISPR TGATGCAGTTAGGGTTAGCT TGG (reversed) Intergenic
No off target data available for this crispr