ID: 1198556675

View in Genome Browser
Species Human (GRCh38)
Location X:137800809-137800831
Sequence TAGGGCCAAATTTATGTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198556670_1198556675 4 Left 1198556670 X:137800782-137800804 CCAAGCTAACCCTAACTGCATCA No data
Right 1198556675 X:137800809-137800831 TAGGGCCAAATTTATGTTTAAGG No data
1198556674_1198556675 -6 Left 1198556674 X:137800792-137800814 CCTAACTGCATCAGTTTTAGGGC No data
Right 1198556675 X:137800809-137800831 TAGGGCCAAATTTATGTTTAAGG No data
1198556672_1198556675 -5 Left 1198556672 X:137800791-137800813 CCCTAACTGCATCAGTTTTAGGG No data
Right 1198556675 X:137800809-137800831 TAGGGCCAAATTTATGTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198556675 Original CRISPR TAGGGCCAAATTTATGTTTA AGG Intergenic
No off target data available for this crispr