ID: 1198565283

View in Genome Browser
Species Human (GRCh38)
Location X:137897640-137897662
Sequence GGGGTGGCACATGGCATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198565275_1198565283 6 Left 1198565275 X:137897611-137897633 CCAGGAGAGGTAAGAAAGGGCAC No data
Right 1198565283 X:137897640-137897662 GGGGTGGCACATGGCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198565283 Original CRISPR GGGGTGGCACATGGCATCCC TGG Intergenic
No off target data available for this crispr