ID: 1198573381

View in Genome Browser
Species Human (GRCh38)
Location X:137983119-137983141
Sequence CTTGACAGTGACTTGGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198573381_1198573386 1 Left 1198573381 X:137983119-137983141 CCCCAACCCAAGTCACTGTCAAG No data
Right 1198573386 X:137983143-137983165 ATACATTATTTTAGTGTTGCTGG No data
1198573381_1198573388 10 Left 1198573381 X:137983119-137983141 CCCCAACCCAAGTCACTGTCAAG No data
Right 1198573388 X:137983152-137983174 TTTAGTGTTGCTGGCTAAATGGG No data
1198573381_1198573389 14 Left 1198573381 X:137983119-137983141 CCCCAACCCAAGTCACTGTCAAG No data
Right 1198573389 X:137983156-137983178 GTGTTGCTGGCTAAATGGGATGG No data
1198573381_1198573387 9 Left 1198573381 X:137983119-137983141 CCCCAACCCAAGTCACTGTCAAG No data
Right 1198573387 X:137983151-137983173 TTTTAGTGTTGCTGGCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198573381 Original CRISPR CTTGACAGTGACTTGGGTTG GGG (reversed) Intergenic
No off target data available for this crispr