ID: 1198575298

View in Genome Browser
Species Human (GRCh38)
Location X:138004175-138004197
Sequence CAGTGTGGCTGGAGCATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198575290_1198575298 7 Left 1198575290 X:138004145-138004167 CCAAAGTTGTTAGCCACTGCCCC No data
Right 1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG No data
1198575289_1198575298 28 Left 1198575289 X:138004124-138004146 CCAGGTGATTTTGAGGTGCAACC No data
Right 1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG No data
1198575291_1198575298 -6 Left 1198575291 X:138004158-138004180 CCACTGCCCCAAAAGTTCAGTGT No data
Right 1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198575298 Original CRISPR CAGTGTGGCTGGAGCATAGA GGG Intergenic
No off target data available for this crispr