ID: 1198590923

View in Genome Browser
Species Human (GRCh38)
Location X:138180487-138180509
Sequence AAGCAACTTCACCAATGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198590922_1198590923 26 Left 1198590922 X:138180438-138180460 CCTGTTTTTCATATTTTAATGTC No data
Right 1198590923 X:138180487-138180509 AAGCAACTTCACCAATGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198590923 Original CRISPR AAGCAACTTCACCAATGCAA TGG Intergenic
No off target data available for this crispr