ID: 1198603330

View in Genome Browser
Species Human (GRCh38)
Location X:138308873-138308895
Sequence TCTTTACCATATATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198603327_1198603330 -10 Left 1198603327 X:138308860-138308882 CCTGATCCAGCTATCTTTACCAT No data
Right 1198603330 X:138308873-138308895 TCTTTACCATATATGGAGCAAGG No data
1198603326_1198603330 -9 Left 1198603326 X:138308859-138308881 CCCTGATCCAGCTATCTTTACCA No data
Right 1198603330 X:138308873-138308895 TCTTTACCATATATGGAGCAAGG No data
1198603324_1198603330 13 Left 1198603324 X:138308837-138308859 CCTATAGAAAGTAGGTCCTGAGC No data
Right 1198603330 X:138308873-138308895 TCTTTACCATATATGGAGCAAGG No data
1198603325_1198603330 -3 Left 1198603325 X:138308853-138308875 CCTGAGCCCTGATCCAGCTATCT No data
Right 1198603330 X:138308873-138308895 TCTTTACCATATATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198603330 Original CRISPR TCTTTACCATATATGGAGCA AGG Intergenic
No off target data available for this crispr