ID: 1198604682

View in Genome Browser
Species Human (GRCh38)
Location X:138323760-138323782
Sequence CTTATGAAGGCTCTGTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198604682_1198604685 -8 Left 1198604682 X:138323760-138323782 CCTGAACACAGAGCCTTCATAAG No data
Right 1198604685 X:138323775-138323797 TTCATAAGCTACTTCTGACTGGG No data
1198604682_1198604684 -9 Left 1198604682 X:138323760-138323782 CCTGAACACAGAGCCTTCATAAG No data
Right 1198604684 X:138323774-138323796 CTTCATAAGCTACTTCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198604682 Original CRISPR CTTATGAAGGCTCTGTGTTC AGG (reversed) Intergenic
No off target data available for this crispr