ID: 1198606823

View in Genome Browser
Species Human (GRCh38)
Location X:138349219-138349241
Sequence TACTAGTTGATTGCATGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198606819_1198606823 27 Left 1198606819 X:138349169-138349191 CCTCTAAAGGAAAACAATAACGT No data
Right 1198606823 X:138349219-138349241 TACTAGTTGATTGCATGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198606823 Original CRISPR TACTAGTTGATTGCATGTTA AGG Intergenic
No off target data available for this crispr