ID: 1198607521

View in Genome Browser
Species Human (GRCh38)
Location X:138357927-138357949
Sequence CTGGCCATGTACCCTTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198607521_1198607534 27 Left 1198607521 X:138357927-138357949 CCATTATAAGGGTACATGGCCAG No data
Right 1198607534 X:138357977-138357999 GCACTTTGGGAGGCTGAGGTGGG 0: 31080
1: 132897
2: 232009
3: 232314
4: 247325
1198607521_1198607531 23 Left 1198607521 X:138357927-138357949 CCATTATAAGGGTACATGGCCAG No data
Right 1198607531 X:138357973-138357995 CCCAGCACTTTGGGAGGCTGAGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
1198607521_1198607533 26 Left 1198607521 X:138357927-138357949 CCATTATAAGGGTACATGGCCAG No data
Right 1198607533 X:138357976-138357998 AGCACTTTGGGAGGCTGAGGTGG 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
1198607521_1198607529 17 Left 1198607521 X:138357927-138357949 CCATTATAAGGGTACATGGCCAG No data
Right 1198607529 X:138357967-138357989 TATAGTCCCAGCACTTTGGGAGG 0: 396
1: 30718
2: 326209
3: 264452
4: 199600
1198607521_1198607527 14 Left 1198607521 X:138357927-138357949 CCATTATAAGGGTACATGGCCAG No data
Right 1198607527 X:138357964-138357986 ACCTATAGTCCCAGCACTTTGGG 0: 119
1: 8126
2: 107048
3: 329318
4: 259331
1198607521_1198607535 30 Left 1198607521 X:138357927-138357949 CCATTATAAGGGTACATGGCCAG No data
Right 1198607535 X:138357980-138358002 CTTTGGGAGGCTGAGGTGGGAGG 0: 23522
1: 76482
2: 160024
3: 176046
4: 158971
1198607521_1198607526 13 Left 1198607521 X:138357927-138357949 CCATTATAAGGGTACATGGCCAG No data
Right 1198607526 X:138357963-138357985 TACCTATAGTCCCAGCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198607521 Original CRISPR CTGGCCATGTACCCTTATAA TGG (reversed) Intergenic
No off target data available for this crispr