ID: 1198607766

View in Genome Browser
Species Human (GRCh38)
Location X:138361873-138361895
Sequence CCTTAGCCTTTCAATAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198607766_1198607771 3 Left 1198607766 X:138361873-138361895 CCCTCTTTATTGAAAGGCTAAGG No data
Right 1198607771 X:138361899-138361921 GGAAAATAATTTTATTTGATAGG No data
1198607766_1198607772 25 Left 1198607766 X:138361873-138361895 CCCTCTTTATTGAAAGGCTAAGG No data
Right 1198607772 X:138361921-138361943 GCTAAGTGTTGACCTATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198607766 Original CRISPR CCTTAGCCTTTCAATAAAGA GGG (reversed) Intergenic
No off target data available for this crispr