ID: 1198610306

View in Genome Browser
Species Human (GRCh38)
Location X:138392314-138392336
Sequence GGCCATAGTTTACCAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198610302_1198610306 30 Left 1198610302 X:138392261-138392283 CCAATACAATTGTACTTGCAAAA No data
Right 1198610306 X:138392314-138392336 GGCCATAGTTTACCAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198610306 Original CRISPR GGCCATAGTTTACCAAACCC TGG Intergenic
No off target data available for this crispr