ID: 1198611880

View in Genome Browser
Species Human (GRCh38)
Location X:138411051-138411073
Sequence CAGCTGACACCCACCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198611875_1198611880 15 Left 1198611875 X:138411013-138411035 CCACTCTGTCACAGCAGAAAGCA No data
Right 1198611880 X:138411051-138411073 CAGCTGACACCCACCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198611880 Original CRISPR CAGCTGACACCCACCCATGG AGG Intergenic
No off target data available for this crispr