ID: 1198616492

View in Genome Browser
Species Human (GRCh38)
Location X:138463600-138463622
Sequence CCTGCTTTGCTGGAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198616492_1198616500 9 Left 1198616492 X:138463600-138463622 CCTACCACCTCCAGCAAAGCAGG No data
Right 1198616500 X:138463632-138463654 CCATGGCTGAGAACCGCAGATGG No data
1198616492_1198616502 22 Left 1198616492 X:138463600-138463622 CCTACCACCTCCAGCAAAGCAGG No data
Right 1198616502 X:138463645-138463667 CCGCAGATGGTTCACATTACAGG No data
1198616492_1198616498 -8 Left 1198616492 X:138463600-138463622 CCTACCACCTCCAGCAAAGCAGG No data
Right 1198616498 X:138463615-138463637 AAAGCAGGTGCTGGTATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198616492 Original CRISPR CCTGCTTTGCTGGAGGTGGT AGG (reversed) Intergenic
No off target data available for this crispr