ID: 1198618040

View in Genome Browser
Species Human (GRCh38)
Location X:138480044-138480066
Sequence GAAGAGTCCCAGACCCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198618038_1198618040 13 Left 1198618038 X:138480008-138480030 CCTCTGAGGCGGCGGGCTCAACT No data
Right 1198618040 X:138480044-138480066 GAAGAGTCCCAGACCCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198618040 Original CRISPR GAAGAGTCCCAGACCCTGTC AGG Intergenic
No off target data available for this crispr