ID: 1198624882

View in Genome Browser
Species Human (GRCh38)
Location X:138559665-138559687
Sequence CAACATGCCTAGGAGGACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198624882_1198624887 5 Left 1198624882 X:138559665-138559687 CCGGGGTCCTCCTAGGCATGTTG No data
Right 1198624887 X:138559693-138559715 TCACATGATGATTGTAGTTGGGG No data
1198624882_1198624885 3 Left 1198624882 X:138559665-138559687 CCGGGGTCCTCCTAGGCATGTTG No data
Right 1198624885 X:138559691-138559713 TCTCACATGATGATTGTAGTTGG No data
1198624882_1198624886 4 Left 1198624882 X:138559665-138559687 CCGGGGTCCTCCTAGGCATGTTG No data
Right 1198624886 X:138559692-138559714 CTCACATGATGATTGTAGTTGGG No data
1198624882_1198624888 22 Left 1198624882 X:138559665-138559687 CCGGGGTCCTCCTAGGCATGTTG No data
Right 1198624888 X:138559710-138559732 TTGGGGTGAGCTGAAGACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198624882 Original CRISPR CAACATGCCTAGGAGGACCC CGG (reversed) Intergenic
No off target data available for this crispr