ID: 1198624884

View in Genome Browser
Species Human (GRCh38)
Location X:138559675-138559697
Sequence TGTGAGAACTCAACATGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198624884_1198624888 12 Left 1198624884 X:138559675-138559697 CCTAGGCATGTTGAGTTCTCACA No data
Right 1198624888 X:138559710-138559732 TTGGGGTGAGCTGAAGACCGTGG No data
1198624884_1198624887 -5 Left 1198624884 X:138559675-138559697 CCTAGGCATGTTGAGTTCTCACA No data
Right 1198624887 X:138559693-138559715 TCACATGATGATTGTAGTTGGGG No data
1198624884_1198624885 -7 Left 1198624884 X:138559675-138559697 CCTAGGCATGTTGAGTTCTCACA No data
Right 1198624885 X:138559691-138559713 TCTCACATGATGATTGTAGTTGG No data
1198624884_1198624886 -6 Left 1198624884 X:138559675-138559697 CCTAGGCATGTTGAGTTCTCACA No data
Right 1198624886 X:138559692-138559714 CTCACATGATGATTGTAGTTGGG No data
1198624884_1198624889 27 Left 1198624884 X:138559675-138559697 CCTAGGCATGTTGAGTTCTCACA No data
Right 1198624889 X:138559725-138559747 GACCGTGGCTGAGATGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198624884 Original CRISPR TGTGAGAACTCAACATGCCT AGG (reversed) Intergenic
No off target data available for this crispr