ID: 1198624885

View in Genome Browser
Species Human (GRCh38)
Location X:138559691-138559713
Sequence TCTCACATGATGATTGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198624882_1198624885 3 Left 1198624882 X:138559665-138559687 CCGGGGTCCTCCTAGGCATGTTG No data
Right 1198624885 X:138559691-138559713 TCTCACATGATGATTGTAGTTGG No data
1198624877_1198624885 25 Left 1198624877 X:138559643-138559665 CCTTATGAGATCAGGAAGTTGTC No data
Right 1198624885 X:138559691-138559713 TCTCACATGATGATTGTAGTTGG No data
1198624883_1198624885 -4 Left 1198624883 X:138559672-138559694 CCTCCTAGGCATGTTGAGTTCTC No data
Right 1198624885 X:138559691-138559713 TCTCACATGATGATTGTAGTTGG No data
1198624884_1198624885 -7 Left 1198624884 X:138559675-138559697 CCTAGGCATGTTGAGTTCTCACA No data
Right 1198624885 X:138559691-138559713 TCTCACATGATGATTGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198624885 Original CRISPR TCTCACATGATGATTGTAGT TGG Intergenic
No off target data available for this crispr