ID: 1198632995

View in Genome Browser
Species Human (GRCh38)
Location X:138662996-138663018
Sequence GGAACTAGTCTTGTTCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198632995_1198633004 13 Left 1198632995 X:138662996-138663018 CCAGCTTGAACAAGACTAGTTCC 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1198633004 X:138663032-138663054 AAGTCTAGAGTCTGGACTAATGG 0: 1
1: 0
2: 0
3: 11
4: 113
1198632995_1198633001 5 Left 1198632995 X:138662996-138663018 CCAGCTTGAACAAGACTAGTTCC 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1198633001 X:138663024-138663046 CACCCTCAAAGTCTAGAGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198632995 Original CRISPR GGAACTAGTCTTGTTCAAGC TGG (reversed) Intronic
905994733 1:42371877-42371899 GGAACAAGTTGTGTTTAAGCTGG + Intergenic
907121240 1:52009925-52009947 GGAACTAGACATGTTCAAGATGG - Intergenic
907548948 1:55287892-55287914 GGAAGTAGGCTTGTAAAAGCTGG + Intergenic
908064831 1:60391622-60391644 GGAACTAGTCCTGTGGAATCTGG - Intergenic
908552376 1:65222271-65222293 GGGACTAGACATGTTCAAGATGG - Intronic
919814386 1:201428438-201428460 GAAACTAATCATTTTCAAGCTGG + Intronic
920299445 1:204979372-204979394 GGAACTGGTCTTCTTCAAACTGG - Exonic
921987955 1:221333103-221333125 GGAACTAGGCATGTTCAAAATGG - Intergenic
1063396167 10:5689895-5689917 GGAACTAGTCTTTTGGAAGAGGG + Intronic
1063482971 10:6392739-6392761 GGGACTAGACATGTTCAAGATGG - Intergenic
1065442172 10:25763984-25764006 GGGACTAGGCTTGTTCAAAATGG + Intergenic
1073948687 10:108782869-108782891 GGGACTAGACATGTTCAAGATGG + Intergenic
1077813917 11:5666918-5666940 GGAACTGGTCTTTTTCCAGGAGG + Intronic
1081196131 11:40163050-40163072 GCACCTAGTCTTGATTAAGCAGG + Intronic
1085187466 11:74588658-74588680 GGGACTAGACATGTTCAAGATGG + Intronic
1085636915 11:78166052-78166074 GGGACTAGACATGTTCAAGATGG - Intergenic
1087979372 11:104592150-104592172 GGAAGTAGCCTGGTTCAAGTAGG + Intergenic
1088422586 11:109665856-109665878 GGAACTAGGCATGTTCAAAATGG + Intergenic
1094359821 12:29618343-29618365 GGACCTAGGGTTGTTCAAGAAGG - Intronic
1095354657 12:41257360-41257382 GGCACTAATCCTGTTCATGCGGG + Intronic
1095639869 12:44475655-44475677 GGGACTAGACATGTTCAAGATGG + Intergenic
1096296380 12:50387753-50387775 GGGACTAGACATGTTCAAGAGGG - Intronic
1104349145 12:128029823-128029845 GGGACTAGACATGTTCAAGATGG + Intergenic
1108159710 13:47625876-47625898 GGAACCCCTCTTCTTCAAGCTGG - Intergenic
1109213989 13:59566516-59566538 GGAACTGTTCTTGTCCAAGAGGG - Intergenic
1112247602 13:97748700-97748722 GGGACTAGACATGTTCAAGATGG - Intergenic
1116104160 14:40477408-40477430 GGGACTAGACATGTTCAAGAAGG - Intergenic
1116691031 14:48105851-48105873 GGGACTAGGCATGTTCAAGGCGG - Intergenic
1117491859 14:56255882-56255904 GGGACTAGCCATGTTCAAGGTGG - Intronic
1119689158 14:76657221-76657243 GGAACTAGACATGTTCAAGATGG + Intergenic
1127179781 15:56402805-56402827 TGAACCAGCCTTGTTCAACCAGG - Intronic
1129673588 15:77620629-77620651 GAAACTAGCCTTTTTCCAGCTGG + Intronic
1131333209 15:91521782-91521804 AGAACTAGACATGTTCAAGATGG - Intergenic
1133679744 16:8109729-8109751 GCAACTAGACATGTTCAAGATGG - Intergenic
1135018467 16:18943907-18943929 GACACTAGTCTTGTTCATGAGGG - Intergenic
1139137741 16:64225148-64225170 GGGACTAGACATGTTCAAGATGG + Intergenic
1139219217 16:65162163-65162185 TTAACTAGTTTTGTTCAATCTGG - Intergenic
1144062314 17:11594291-11594313 GGGACTAGACATGTTCAAGATGG + Intergenic
1148975153 17:51521018-51521040 GGAACTAGTGTTTTTCATGCGGG + Intergenic
1149080541 17:52651232-52651254 AGAACTAGACATGTTCAAGATGG - Intergenic
1153751431 18:8235318-8235340 GGAACTGGTCTATTTCAACCAGG + Intronic
1155591195 18:27429036-27429058 GGAGCTAGTCTAGTTCTAGGAGG - Intergenic
1156560917 18:38124103-38124125 GGGACTAGACATGTTCAAGATGG - Intergenic
1156643893 18:39136094-39136116 GGGACTAGACATGTTCAAGATGG - Intergenic
925931415 2:8711099-8711121 TAAACTAGTCTTGTTCTAGAAGG - Intergenic
928323675 2:30303146-30303168 GGAAGAAGTGCTGTTCAAGCTGG - Intronic
931209933 2:60182947-60182969 GGAACTAGTACTGCTCAAGGTGG + Intergenic
931368429 2:61639792-61639814 GGGACTAGACATGTTCAAGATGG + Intergenic
934046534 2:88177526-88177548 GAAAATATTCTTGTTGAAGCTGG - Intronic
936581017 2:113700617-113700639 GGAACTAGACTTACTCAAGGTGG - Intergenic
938032315 2:128005583-128005605 AGACCTAGTCTTGCTCAGGCTGG - Intronic
948270187 2:236668081-236668103 GGAACTGGTCTTGTTGAATCTGG + Intergenic
1174777538 20:53358997-53359019 TGAACCAGTCTTTTTCAAGATGG + Intronic
1176123335 20:63464063-63464085 AGACCTAATTTTGTTCAAGCTGG + Intronic
1176675422 21:9772694-9772716 GGGACTAGACATGTTCAAGATGG - Intergenic
1180900717 22:19370002-19370024 GAGACAAGTCTTGTTCAGGCTGG + Intronic
1184530145 22:45050365-45050387 GGAACTAGTTTTTTTCTAGGTGG - Intergenic
952704814 3:36366535-36366557 GGGACTAGACATGTTCAAGATGG - Intergenic
953070210 3:39512924-39512946 GGAACAAATCGTGTTCAAGAAGG - Intronic
961383782 3:126512691-126512713 GGGTCTAGTTTTGTCCAAGCTGG - Intronic
961466592 3:127085510-127085532 GGACCTGGCCTTGTCCAAGCAGG + Intergenic
971261252 4:25058873-25058895 GGAACTAGACATCTTCAAGATGG + Intergenic
975926104 4:79455709-79455731 GTAACTTGTCTTCTTTAAGCTGG - Intergenic
978018919 4:103785005-103785027 GGGACTAGACATGTTCAAGAAGG + Intergenic
981338929 4:143598040-143598062 GGAACTAGTAGTGTTCATGAGGG + Intronic
981439039 4:144761109-144761131 GGGACTAGACATGTTCAAGATGG - Intergenic
983337764 4:166418612-166418634 GGTACTAGACATGTTCAAGATGG + Intergenic
984539818 4:181023534-181023556 GGCACTAATCTTGTTCATGAGGG - Intergenic
985400128 4:189586003-189586025 GGGACTAGACATGTTCAAGATGG + Intergenic
989154835 5:38334472-38334494 GGAACTAATCCTGTTCATGAGGG + Intronic
990500892 5:56396324-56396346 GGCACTAATTTTGTTCAAGTGGG + Intergenic
991169745 5:63608254-63608276 GGAGCAAGTCTTGTGAAAGCTGG + Intergenic
994787448 5:104182242-104182264 GAAACTAGACATGTTCAAGATGG + Intergenic
999975620 5:156909200-156909222 GGGACTAGACATGTTCAAGATGG + Intergenic
1004614083 6:17273166-17273188 GGGACTAGACATGTTCAAGATGG + Intergenic
1004826416 6:19426049-19426071 GGGACTAGACGTGTTCAAGAGGG - Intergenic
1011595244 6:89009789-89009811 GGAACCAGACATGTTCAAGATGG + Intergenic
1011888472 6:92127174-92127196 GGGACTAGGCATGTTCAAACTGG + Intergenic
1012825827 6:104145569-104145591 GGGACTAGGCATGTTCAAGATGG + Intergenic
1013178019 6:107693810-107693832 GGAAATCGTTTTGTTCAAGGCGG + Intergenic
1015515562 6:134079601-134079623 GGGACTAGGCATGTTCAAACTGG + Intergenic
1017904283 6:158746139-158746161 GGCACTAATCTTGTTCATGAGGG + Intronic
1022958467 7:35402504-35402526 GGCACTAATCCTGTTCAAGAGGG - Intergenic
1023078454 7:36505792-36505814 GGGACTAGACATGTTCAAGATGG + Intergenic
1023392366 7:39722390-39722412 GGGACTAGACATGTTCAAGGTGG - Intergenic
1024009492 7:45255423-45255445 GGGACTAGACATGTTCAAGATGG - Intergenic
1027756047 7:82213331-82213353 GGAGCTAGTCTTGTTGAGGCTGG + Intronic
1028252046 7:88548058-88548080 GGGACTAGACATGTTCAAGATGG - Intergenic
1030542279 7:110845828-110845850 GGCACTAGTCTCGTTCATGAGGG - Intronic
1031416578 7:121503118-121503140 GGAACTAGACATGTTCAAGATGG + Intergenic
1032416193 7:131737283-131737305 GGACCTAGTCTTCTTGGAGCAGG + Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1036731857 8:11272652-11272674 GGATCTAATCATCTTCAAGCTGG + Intergenic
1037097246 8:15000562-15000584 GGGACTAGACATGTTCAAGATGG + Intronic
1039184285 8:34899506-34899528 GGGACTAGACATGTTCAAGATGG + Intergenic
1040664838 8:49619911-49619933 GGGACTAGACATGTTCAAGATGG - Intergenic
1044301625 8:90591131-90591153 GGAACTAGGCATGTTCAAAATGG + Intergenic
1047354713 8:124109397-124109419 GGGACTAGACATGTTCAAGAAGG - Intronic
1047441049 8:124879093-124879115 GGCACTAGTCCTGTTCATGAGGG + Intergenic
1055188050 9:73480274-73480296 GGGACAAGTCAAGTTCAAGCTGG - Intergenic
1055617704 9:78090432-78090454 GGATCTATTCTTGGTCAAGACGG + Intergenic
1055680669 9:78711953-78711975 GGAACCAGTTTTGCTCAAGGAGG + Intergenic
1055972162 9:81922156-81922178 GGGACTAGACATGTTCAAGATGG - Intergenic
1055973915 9:81937228-81937250 GGGACTAGACATGTTCAAGATGG - Intergenic
1196375672 X:115030078-115030100 GGAACCAGTCGTCTTAAAGCTGG - Intergenic
1197616250 X:128695136-128695158 GAAGCTAGTCTGGTTGAAGCAGG + Intergenic
1198632995 X:138662996-138663018 GGAACTAGTCTTGTTCAAGCTGG - Intronic
1201329143 Y:12799265-12799287 GGGACTAGACATGTTCAAGATGG - Intronic