ID: 1198634644

View in Genome Browser
Species Human (GRCh38)
Location X:138682501-138682523
Sequence GGTTTGGAAGACTGCACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198634644_1198634647 27 Left 1198634644 X:138682501-138682523 CCTACAGTGCAGTCTTCCAAACC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1198634647 X:138682551-138682573 TGAATAAATGTGAGTAATTGTGG 0: 1
1: 0
2: 1
3: 27
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198634644 Original CRISPR GGTTTGGAAGACTGCACTGT AGG (reversed) Intronic
900736791 1:4304214-4304236 GGATGGGAAGACTGCAAGGTGGG - Intergenic
900842456 1:5065169-5065191 GGTATGGATTACAGCACTGTTGG + Intergenic
903610600 1:24608931-24608953 CCCTTAGAAGACTGCACTGTGGG - Exonic
908246439 1:62230974-62230996 GGGCTGGATGACTCCACTGTGGG + Intergenic
911849384 1:102797488-102797510 GGATTAGAAGACTGAACTATCGG + Intergenic
914313610 1:146488398-146488420 GGTTTGGAAAGCTGGACTCTTGG - Intergenic
914500738 1:148244983-148245005 GGTTTGGAAAGCTGGACTCTTGG + Intergenic
914504386 1:148276049-148276071 GGTTTGGAAAGCTGAACTCTTGG + Intergenic
915803076 1:158815419-158815441 GGTTGAGATGACTGCAATGTAGG + Intergenic
918720675 1:187848529-187848551 GCTTTAGATGATTGCACTGTGGG - Intergenic
921308111 1:213817196-213817218 GGTTTGGAAGACTAAGCTGGAGG - Intergenic
924167640 1:241301859-241301881 TTTTTGGAAGACTGAGCTGTTGG - Intronic
1066261032 10:33729880-33729902 GGTTTGGGAAAGAGCACTGTGGG + Intergenic
1068729625 10:60342210-60342232 TTTTTGGAATACTGCAGTGTAGG - Intronic
1072312782 10:94172246-94172268 GGTTGGGCGGACTGCACTCTTGG + Intronic
1074668629 10:115761080-115761102 CGTTTCAAAGACTGCACTGTTGG + Intronic
1075690912 10:124393570-124393592 AGTCTGAAAGACTGAACTGTTGG - Intergenic
1076447431 10:130526270-130526292 GGTCTGGAAGACTGATCTGGGGG + Intergenic
1076589188 10:131571513-131571535 AGTTTTGAAGTCTGAACTGTTGG + Intergenic
1080601743 11:33827961-33827983 GGTCTGGAAGCCTGCAATGCAGG - Intergenic
1082255738 11:50030274-50030296 GATTTGGAAACCTTCACTGTAGG - Intergenic
1084983139 11:72843522-72843544 GGTTGAGAAGCCTGCAGTGTAGG + Exonic
1085111113 11:73889568-73889590 GATTTGCAAGACTGCAAAGTAGG + Intronic
1087648556 11:100837242-100837264 AATTTGGATAACTGCACTGTAGG - Intronic
1088708194 11:112482561-112482583 GGTTTAGGAGACTTCACTGAAGG + Intergenic
1091256749 11:134194664-134194686 CGTTAGGAAGTCTGCACTGCAGG - Exonic
1098677527 12:73309422-73309444 GGTTTGAAAAACTGCCCTATTGG - Intergenic
1100725669 12:97406053-97406075 GGTGTGCAAGAAGGCACTGTAGG - Intergenic
1101662231 12:106775773-106775795 GGTTTAGAAGACTGCTTTATAGG + Intronic
1102206204 12:111092475-111092497 TGTTGGGAAGACATCACTGTGGG + Intronic
1102741237 12:115209312-115209334 GCATTGGAGGACTGCCCTGTGGG + Intergenic
1103049052 12:117763498-117763520 GGTTTTGAAGCCTGCACATTTGG - Intronic
1104619682 12:130301785-130301807 AATTTGGAAGGCTGCAGTGTTGG - Intergenic
1104646255 12:130499709-130499731 GGTTGGGGAGACCTCACTGTGGG - Intronic
1106443478 13:29801527-29801549 GATTGGGGAGACTGCACTGCTGG - Intronic
1107400603 13:40065339-40065361 GGTCTGCCAGATTGCACTGTGGG - Intergenic
1109759276 13:66805808-66805830 GGTTTGGCAGACTGCCCTTTTGG + Intronic
1109855788 13:68126177-68126199 GCTTTGGAAGAGTTCACTGTTGG + Intergenic
1110295917 13:73865768-73865790 GGTTTTGTAGACTGCAGTTTTGG - Intronic
1110516726 13:76421452-76421474 CCTTTGAAACACTGCACTGTTGG - Intergenic
1113936758 13:113998949-113998971 GGTTTTGGGGACTGCACGGTGGG + Intronic
1118448136 14:65870432-65870454 GGTCTGGAAGACCTCACTGGAGG + Intergenic
1118564657 14:67126169-67126191 TGTTTGGAACACAGTACTGTTGG + Intronic
1122106824 14:99464217-99464239 AGTTTGAAAGACTGCACACTGGG + Intronic
1125274671 15:37978137-37978159 GGTTGGGACAACTGTACTGTGGG + Intergenic
1126306775 15:47267989-47268011 TGGTTTGAAGACTGCACTATGGG - Intronic
1131552099 15:93365859-93365881 GCTTTGGAAGCCTGCAGAGTAGG + Intergenic
1132780487 16:1621718-1621740 GCTTTCAAAGAGTGCACTGTTGG + Intronic
1136594703 16:31239918-31239940 GGGTTGGATGACAGCACTGGTGG + Intergenic
1138819698 16:60244260-60244282 GGATTGGAAAACTGCAGTCTGGG - Intergenic
1142688225 17:1590228-1590250 TGTTTGGAAAAGTGGACTGTGGG + Intronic
1146552929 17:33797746-33797768 TGTTTGGAGGACTGAAATGTGGG + Intronic
1146800961 17:35821844-35821866 TGTTTAGAAGACTGTACTATAGG + Intronic
1146961138 17:36980654-36980676 GGCTGGGAAGAATTCACTGTTGG + Intronic
1149633271 17:58143652-58143674 GGGATGGCAGCCTGCACTGTTGG + Intergenic
1153082747 18:1247490-1247512 GGTTTGGAAGCCAGCTCTTTTGG + Intergenic
1153579448 18:6557545-6557567 CCTTAGGAAGACTTCACTGTTGG + Intronic
1156419294 18:36933630-36933652 GGTGTGGAGGACAGAACTGTGGG - Intronic
1157955089 18:52087947-52087969 GGTTTGGAGGACTGGAATGTGGG + Intergenic
1161498369 19:4599268-4599290 GGCATGGAAGACCCCACTGTGGG - Intergenic
1162461284 19:10815776-10815798 GGTTTGGGGGAATGCTCTGTAGG + Intronic
1162966918 19:14160471-14160493 GGTCTGGAAGGCAGGACTGTGGG - Intronic
1164601968 19:29568338-29568360 GTTTGGGAAGAATGCACTGTGGG + Intergenic
1165099782 19:33432161-33432183 GGTTTGGAAGCAAGCTCTGTCGG + Intronic
1165783174 19:38445619-38445641 GGTTTGGAAGTCTGAGCTTTGGG - Intronic
1165875093 19:39001013-39001035 GTTTTGGAGGAGTGCTCTGTGGG + Intronic
1166018003 19:39997601-39997623 AGGTTGGAAGACTGCGCAGTTGG + Intronic
1167252775 19:48409642-48409664 TGTTTGGGAGCCTGCACTGCTGG + Intronic
925093490 2:1174186-1174208 AGTATGGAAGACTGCACAGATGG - Intronic
932323699 2:70840185-70840207 GGTTAGGAAGACTGAACTATGGG - Intergenic
936786227 2:116096686-116096708 GGTATGGCAGAAGGCACTGTTGG + Intergenic
941787949 2:169519416-169519438 GTTTTCGAAGACTGTAATGTGGG + Intronic
943045410 2:182854991-182855013 GATTTCAAAAACTGCACTGTAGG + Intronic
943092253 2:183389552-183389574 GGTTAGGAAGATTGTACTGGGGG + Intergenic
944024517 2:195147238-195147260 TGTTTGGAGGACTGTAATGTTGG - Intergenic
1171976204 20:31596210-31596232 CGGCTGGAAGATTGCACTGTGGG + Intergenic
1181731757 22:24852175-24852197 GGTTTTGATCACTGCACTATGGG - Intronic
1183018709 22:35010090-35010112 GGTTAGGAAAAATGCTCTGTCGG - Intergenic
950134984 3:10574818-10574840 GGGGTGGGAGACTGCACGGTAGG + Intronic
954164898 3:48748879-48748901 GTTTTGGAAAGCTGCAATGTAGG + Exonic
956710907 3:72037974-72037996 GGTCTGGAAGGCTGCTCTGATGG + Intergenic
957137435 3:76307359-76307381 GGTTAGGAAGACTGCAGAGAAGG - Intronic
961934620 3:130570083-130570105 GTTTTGGAACACTGCACCTTTGG + Intronic
962599328 3:136979177-136979199 GGTCAGGAAGACTGCCTTGTGGG + Intronic
963981697 3:151545306-151545328 AGTTTGGCAGAATTCACTGTAGG + Intergenic
966634004 3:182111978-182112000 GGTGTGAAAGACTGTAATGTAGG + Intergenic
970139723 4:12968743-12968765 GGTTTAGAAAATAGCACTGTTGG - Intergenic
972298042 4:37758976-37758998 GGTTTGGAAGTCTGCCTTTTAGG + Intergenic
975059384 4:69978612-69978634 GGATTGGGTGGCTGCACTGTAGG + Intergenic
975890759 4:79024362-79024384 GGTTTTGAAGACTCCGCTTTGGG + Intergenic
977846403 4:101772982-101773004 GGGTTGGGTGGCTGCACTGTAGG + Intronic
978263023 4:106785270-106785292 GTTTTTGAAGAATGCACTGTTGG + Intergenic
978461752 4:108962571-108962593 GGTTTGGAATGCTACACTGGAGG + Intronic
984177216 4:176434437-176434459 GGTTTGGAAGATTTCAGTATCGG + Intergenic
986714413 5:10512489-10512511 GGTTTGTGAGACTGCTGTGTTGG - Intronic
991457637 5:66821899-66821921 GGGTTGGGAGACAGGACTGTGGG + Intronic
994963163 5:106630571-106630593 GGTTTGGATGAGTGTGCTGTTGG + Intergenic
997777775 5:136626910-136626932 TGTCTGGAAGAAAGCACTGTAGG + Intergenic
999120865 5:149208522-149208544 GGTATGGAAGCCTGGAGTGTTGG - Intronic
1000928958 5:167229413-167229435 GGTTCTGAACACTGCACAGTGGG + Intergenic
1002412755 5:179096360-179096382 GGTCTAGAAGACTGTACTGTAGG + Intergenic
1002495766 5:179610437-179610459 GGCCTGGAAGACTTGACTGTTGG - Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006113849 6:31764874-31764896 GGTTAGGAAAAGTGCATTGTGGG + Intergenic
1007346988 6:41238468-41238490 GGTTCGGAATGATGCACTGTGGG - Intronic
1013352215 6:109316121-109316143 TTTTTGGAAGACTTTACTGTTGG + Intergenic
1014082406 6:117302890-117302912 GGTTTGGAAACCTCCTCTGTAGG - Intronic
1017350785 6:153439394-153439416 TTCTTGGATGACTGCACTGTAGG - Intergenic
1020940178 7:14523486-14523508 TGTATGGAAGACTATACTGTAGG - Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1027597336 7:80190611-80190633 TGTTTAAAAGACTGCACAGTAGG + Intronic
1029984126 7:104905979-104906001 TGCTGGGAAGACTGTACTGTGGG + Intronic
1030535283 7:110758627-110758649 GTATTGGAAGATTGTACTGTAGG - Intronic
1033974548 7:147085232-147085254 GGCTGGGAAAACTGTACTGTAGG + Intronic
1036425233 8:8639448-8639470 AGTATGGAAAACTTCACTGTTGG + Intergenic
1037371271 8:18181916-18181938 GGTTTGGAATCAGGCACTGTGGG + Intronic
1037757505 8:21720710-21720732 GGTTTGGAAGGGTGAACTGGAGG - Intronic
1037804230 8:22050276-22050298 GGTGTAGAAGACTGGACTTTGGG + Intronic
1040426411 8:47291760-47291782 GGTTGGGAAGAAGGCAGTGTGGG - Intronic
1040529924 8:48258299-48258321 AGTATGAAAGACTGCACTGCAGG - Intergenic
1041740809 8:61154591-61154613 GGATTGTCAGACTTCACTGTTGG - Intronic
1046958653 8:120086905-120086927 GGTTAGGCTGACTCCACTGTAGG + Intronic
1047887943 8:129273617-129273639 GGTTTGGAAGACCGTCTTGTAGG - Intergenic
1053173974 9:35909381-35909403 GGGTTGGAGGGCTGCAGTGTGGG + Intergenic
1053386426 9:37694155-37694177 GGTTTTGCAGACCCCACTGTGGG - Intronic
1056514909 9:87341054-87341076 TCTTTGGAAGACAGCACAGTGGG - Intergenic
1061258881 9:129468162-129468184 CGTTTTGAAGACTGCAATGATGG - Intergenic
1061473992 9:130850841-130850863 GGTTTGGTAGTCTTGACTGTAGG - Intronic
1062686896 9:137818398-137818420 GGTTTGGAGGACTGGAGTGGTGG - Intronic
1185524186 X:764326-764348 GGTCTCGAAGTCTGCCCTGTTGG + Intergenic
1186732850 X:12428952-12428974 GGATTGATAGACTTCACTGTGGG + Intronic
1188470239 X:30530011-30530033 GGTTTGCAAGACTGCAATTGAGG + Intergenic
1189094936 X:38128059-38128081 GGTATGGTAGATTGAACTGTTGG - Exonic
1189698182 X:43687482-43687504 GGTTTGAAGGACAGCACTGATGG + Intronic
1193961006 X:87924645-87924667 AGTTTGGGTGGCTGCACTGTGGG - Intergenic
1194860278 X:98990862-98990884 AGTTTGAATGACTGCCCTGTTGG - Intergenic
1196490863 X:116264517-116264539 GATATGTAATACTGCACTGTGGG - Intergenic
1197164662 X:123363507-123363529 TCTTTGGAAGACTGAATTGTCGG + Intronic
1197913791 X:131513671-131513693 GGGTGGGGCGACTGCACTGTTGG + Intergenic
1198634644 X:138682501-138682523 GGTTTGGAAGACTGCACTGTAGG - Intronic
1199348185 X:146767216-146767238 TATTTAGAAGACTGCAATGTTGG + Intergenic