ID: 1198636866

View in Genome Browser
Species Human (GRCh38)
Location X:138711180-138711202
Sequence CGCCGCCGGAGGAGCTCGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198636866_1198636878 10 Left 1198636866 X:138711180-138711202 CCGTCCGAGCTCCTCCGGCGGCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 1198636878 X:138711213-138711235 CGCGCGGGCTGCTGGCTGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 243
1198636866_1198636879 11 Left 1198636866 X:138711180-138711202 CCGTCCGAGCTCCTCCGGCGGCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 1198636879 X:138711214-138711236 GCGCGGGCTGCTGGCTGCCTGGG 0: 1
1: 1
2: 4
3: 23
4: 246
1198636866_1198636880 15 Left 1198636866 X:138711180-138711202 CCGTCCGAGCTCCTCCGGCGGCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 1198636880 X:138711218-138711240 GGGCTGCTGGCTGCCTGGGTCGG 0: 1
1: 0
2: 9
3: 74
4: 632
1198636866_1198636875 2 Left 1198636866 X:138711180-138711202 CCGTCCGAGCTCCTCCGGCGGCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 1198636875 X:138711205-138711227 CCGGCTCCCGCGCGGGCTGCTGG 0: 1
1: 0
2: 4
3: 26
4: 277
1198636866_1198636873 -5 Left 1198636866 X:138711180-138711202 CCGTCCGAGCTCCTCCGGCGGCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 1198636873 X:138711198-138711220 CGGCGGTCCGGCTCCCGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 97
1198636866_1198636872 -6 Left 1198636866 X:138711180-138711202 CCGTCCGAGCTCCTCCGGCGGCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 1198636872 X:138711197-138711219 GCGGCGGTCCGGCTCCCGCGCGG 0: 1
1: 0
2: 3
3: 16
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198636866 Original CRISPR CGCCGCCGGAGGAGCTCGGA CGG (reversed) Exonic