ID: 1198637911

View in Genome Browser
Species Human (GRCh38)
Location X:138720094-138720116
Sequence AATAGTGCCCGGAGTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198637911 Original CRISPR AATAGTGCCCGGAGTAGAGT TGG (reversed) Intronic
903024539 1:20418018-20418040 CACAGTGCCCGGTGCAGAGTAGG - Intergenic
903760402 1:25694033-25694055 AACAGTGCCTGGTGCAGAGTAGG + Intronic
905011433 1:34749605-34749627 AATAGTGCCTGGTGCATAGTAGG - Intronic
907769249 1:57443559-57443581 AATAGTGCCTGGAACAGAGTTGG - Intronic
907896103 1:58693512-58693534 AATAGTGCCTTTCGTAGAGTTGG - Intronic
910155424 1:84212775-84212797 AATAGTGCCTGGCATATAGTAGG + Intronic
911334708 1:96568369-96568391 AATAGTACCCTGAGTAGATTAGG - Intergenic
915225688 1:154409675-154409697 AATAGTGCCTGGAACAGAGTAGG - Intronic
923054279 1:230413872-230413894 CATAGTGCCTGGTGCAGAGTAGG + Intronic
924090544 1:240496686-240496708 AACAGTGCCTGGTGTACAGTAGG + Intronic
924640538 1:245829289-245829311 AATAGTGCCCAGTGTACAATAGG - Intronic
1063560124 10:7118495-7118517 AATAGTGCCCGGCACAGAGCAGG + Intergenic
1063875966 10:10478990-10479012 GATAATGCCAGGAGAAGAGTGGG - Intergenic
1064813909 10:19234697-19234719 CATAGTGTCTGGAGTATAGTAGG - Intronic
1065073249 10:22049684-22049706 AATAGTGCCTGGCATAGAGTAGG - Intergenic
1065283467 10:24164514-24164536 AATAGTTCTTGGTGTAGAGTGGG + Intronic
1068926905 10:62549868-62549890 AATGGTGCCTGGAATATAGTAGG + Intronic
1072673930 10:97451760-97451782 ACTAGACCCCGGAGTAGAGGTGG - Exonic
1072766616 10:98099621-98099643 AACAGTGCCCGGTGCATAGTAGG + Intergenic
1073273846 10:102290835-102290857 AATAGTCCCATAAGTAGAGTGGG + Intronic
1075468507 10:122670545-122670567 AATGCTGGCCTGAGTAGAGTAGG - Intergenic
1075510657 10:123070198-123070220 AATAGTGCTGGGGGTAGAATGGG - Intergenic
1075844781 10:125536391-125536413 AATAGTGCCCGGGGTCCGGTGGG + Intergenic
1077988256 11:7377188-7377210 AACAGTGCCTGGCATAGAGTGGG - Intronic
1078148150 11:8736222-8736244 AATAGTGCCTGGAATAGACTTGG - Intronic
1078350232 11:10586843-10586865 AATAGTGCCTGGCATACAGTAGG + Intronic
1080896407 11:36452160-36452182 AATGGTGCCTGGCGTATAGTAGG + Intronic
1081438940 11:43058857-43058879 AATTGTGCCTGGAGCACAGTGGG + Intergenic
1081540235 11:44029466-44029488 AACAGTGCCTGGTGCAGAGTAGG + Intergenic
1085645595 11:78220300-78220322 CAAGGTGCCTGGAGTAGAGTTGG - Exonic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1093008038 12:14072240-14072262 CATAGTGCCTGGCATAGAGTAGG - Intergenic
1099175974 12:79422580-79422602 AATGGTGCAGGGAGTAGAGAGGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1104097408 12:125570099-125570121 CATACTGCCCGGGGTGGAGTAGG - Intronic
1106435459 13:29719865-29719887 TATAGAGCCTGCAGTAGAGTGGG + Intergenic
1107246476 13:38302310-38302332 AATAGTGCCTGGCATATAGTGGG + Intergenic
1114806392 14:25841838-25841860 AATAGTGCACAGAATAGAGCTGG - Intergenic
1117570125 14:57039790-57039812 AACAGTGCCTGGAAGAGAGTGGG + Intergenic
1117570355 14:57042302-57042324 AAAACTGCCAGGAGAAGAGTAGG - Intergenic
1117570557 14:57044820-57044842 AAAACTGCCAGGAGAAGAGTAGG + Intergenic
1119217092 14:72877253-72877275 AGTAGAGCCTGGAGGAGAGTGGG + Intronic
1121932332 14:97983719-97983741 TATAGTGCCTGGCGCAGAGTAGG - Intergenic
1122594248 14:102878530-102878552 AATACTGCCCGGCGCACAGTAGG - Intronic
1124206210 15:27723281-27723303 AATAATGCCTGGAGCATAGTAGG + Intergenic
1125392527 15:39209787-39209809 AAGAGGGCCTGGTGTAGAGTAGG + Intergenic
1127295490 15:57605127-57605149 AACAGTGCCTGGAATACAGTAGG - Intronic
1127307950 15:57726708-57726730 AAAAGTGCTCTGAGGAGAGTTGG + Intronic
1131630060 15:94166621-94166643 AATAGTGCCCAGAATAAAATCGG - Intergenic
1134674466 16:16079721-16079743 AATAGTGCCCAGTATATAGTAGG + Intronic
1134805434 16:17120147-17120169 CATAGTGCCCGGAACACAGTAGG + Intronic
1135706270 16:24677753-24677775 AATAGTGCCTGGTGCAAAGTAGG + Intergenic
1136003085 16:27311141-27311163 AATAGTGCCTGGCGTGGATTAGG - Intergenic
1136023669 16:27456212-27456234 AATAGTGCCTGGTATAGAGCAGG + Intergenic
1136052362 16:27660925-27660947 AAAAGTGCCTGGCATAGAGTTGG + Intronic
1140055493 16:71522027-71522049 AATTGTCCCAGGAGTAGAGTTGG - Intronic
1141220891 16:82068464-82068486 AACAGTGCCCAGAGTGGAGTGGG - Intronic
1146146153 17:30418455-30418477 AATAGTGCCTGGCATATAGTAGG - Intronic
1146678569 17:34790955-34790977 AATAGTGCCTGGCATAGAGAAGG - Intergenic
1151074970 17:71260812-71260834 AACAGTGCCCGGTGTAGAGTAGG + Intergenic
1162875228 19:13616442-13616464 AACAGTGCCTGGAATACAGTAGG - Intronic
1164305182 19:24000044-24000066 AATAGTGCCAAGTGCAGAGTCGG - Intergenic
1164538152 19:29102040-29102062 ACTAGTGCCTGAAGTAGGGTGGG + Intergenic
1166006546 19:39911688-39911710 AATAGTGCCTGGAATACAGAAGG + Intronic
1168508611 19:56956902-56956924 AATATTTCCCGGAGTGGAGGGGG - Intergenic
925796175 2:7545216-7545238 AATAGTGCCCGGCATTAAGTAGG + Intergenic
926663722 2:15496750-15496772 AAAAGTGCCTGGAATAGAATAGG - Intronic
930224275 2:48776600-48776622 AATAATGTTCGGAGTAGAGATGG - Intergenic
930357577 2:50341423-50341445 AAAAGTGCCCAGACTATAGTAGG - Intronic
931502350 2:62882920-62882942 AATATTGCCCGGCATACAGTAGG - Intronic
940305763 2:152224579-152224601 CATAGTGCCAGGAGGACAGTCGG - Intergenic
941013206 2:160324834-160324856 AATAGTGCCTGGCATAGAGTAGG - Intronic
944108054 2:196100863-196100885 AATAGTGCCCTTTGTACAGTTGG - Intergenic
944151019 2:196558949-196558971 TATAGTGCCTGGCATAGAGTAGG - Intronic
944487224 2:200219590-200219612 AATATTGACAGGAGTAGGGTAGG - Intergenic
947013093 2:225587776-225587798 AATAATGACAGGAGTTGAGTGGG - Intronic
947964037 2:234264168-234264190 AATAGTGCCTGGAATATAGTTGG + Intergenic
1170574628 20:17653061-17653083 AAGTGTGCCCGGAGCAGAGAAGG + Intronic
1175321480 20:58091234-58091256 AATAGTGGTCGGAGTGAAGTTGG - Intergenic
1175374023 20:58512798-58512820 AATAGTGCCCGGTGTAGAGCTGG + Intronic
1178005612 21:28216782-28216804 AATGGTACCCGGAGTAGCGGGGG + Intergenic
1179245693 21:39632366-39632388 AATGGAGGCCGGAGTACAGTGGG + Intronic
1182095810 22:27624758-27624780 AACAGTGCCTGGCATAGAGTAGG - Intergenic
1183010354 22:34941375-34941397 ATTAGTTCCCGGAGTAGAGTAGG + Intergenic
1183591618 22:38782446-38782468 AACAGTGCCCGGCATAGAGTAGG + Intronic
1184008670 22:41730262-41730284 ATTAGTGGCGGAAGTAGAGTTGG - Intronic
950218822 3:11178938-11178960 AATAGTGCCTGGCGTGGAGTAGG + Intronic
951443364 3:22748102-22748124 AATAATGCCTGGTGTATAGTAGG - Intergenic
953035254 3:39205589-39205611 AAGAGTGCCCAGCATAGAGTGGG - Intergenic
953164286 3:40450858-40450880 AACAGTGCCTGGAGTGGAATAGG - Intergenic
956329109 3:68085458-68085480 AATAATGCCTGAATTAGAGTGGG + Intronic
963768416 3:149363130-149363152 AATAGTGCCTGGCATATAGTAGG - Intergenic
964512220 3:157465212-157465234 AATAGTGCCTGGCATATAGTAGG - Intronic
965487324 3:169293762-169293784 AATAGTGCCTGGAACATAGTAGG + Intronic
965630615 3:170728684-170728706 AATAGTGCCTGGTACAGAGTAGG + Intronic
966148100 3:176834696-176834718 AATAGTGTCTGGTGTTGAGTAGG - Intergenic
969429513 4:7145959-7145981 AATGGTGCCTGGCATAGAGTAGG + Intergenic
970653263 4:18201340-18201362 GATAGTGCCTGGAATAGAGTAGG + Intergenic
971134938 4:23858188-23858210 TATAGTGCCTGGAATAGAGGGGG - Intronic
971272281 4:25161105-25161127 AACAGTGCCCAGAATAAAGTAGG + Intronic
972369321 4:38407516-38407538 AATAGTGCCTGGCATATAGTAGG - Intergenic
975953953 4:79813279-79813301 AAAAGTGCCCGGAATATAGTAGG - Intergenic
977330650 4:95633208-95633230 AATAGTACCTGGATTATAGTAGG + Intergenic
978710940 4:111780237-111780259 AATAGTGCCTGAGGTATAGTAGG - Intergenic
980021214 4:127712475-127712497 AATAGTGTCTGGTGCAGAGTAGG - Intronic
981624638 4:146741801-146741823 AGTTGTGACGGGAGTAGAGTAGG - Intronic
984434265 4:179688353-179688375 AATAGTGCACTAAGTAGATTAGG - Intergenic
986475137 5:8121960-8121982 CATAGTGCTTGGAGTAGAATAGG + Intergenic
986721114 5:10562675-10562697 AAGAATCCCCGGAGTAGAGAAGG + Intergenic
988734105 5:34003377-34003399 AACAGTGCCTGGCGTACAGTGGG - Intronic
996185772 5:120473667-120473689 AACAGTGCCTGGTGTACAGTAGG - Intronic
997498786 5:134354577-134354599 AATAGTGCCTGGCATATAGTAGG - Intronic
998197662 5:140089075-140089097 AATAGTACCCAGAATATAGTAGG - Intergenic
1000239951 5:159400038-159400060 AATACTGCCCAGCCTAGAGTTGG - Intergenic
1001572737 5:172741184-172741206 AATAGTGCCCGGCACATAGTAGG - Intergenic
1001592408 5:172874488-172874510 AAAAGTGTCCGGCATAGAGTAGG - Intronic
1003319675 6:5039306-5039328 AACAGTGCCTGGAATATAGTTGG - Intergenic
1008220117 6:48844800-48844822 AATACTGCCTGGTGAAGAGTAGG + Intergenic
1012132289 6:95512373-95512395 AATAATGGGCGAAGTAGAGTGGG + Intergenic
1015609769 6:135004156-135004178 CATAGTGCCTGGTGTATAGTAGG - Intronic
1018155260 6:160979768-160979790 AAAAGTGCCTAGAGTGGAGTGGG - Intergenic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1030626938 7:111854765-111854787 AATAGTGCCTGGTGCAAAGTAGG - Intronic
1031916931 7:127572200-127572222 AATAGTGCCTGGGATAGAATAGG + Intergenic
1039365393 8:36923225-36923247 AACAGTGCCCTGTGCAGAGTAGG - Intronic
1040897848 8:52387961-52387983 AATAGTGCCCGGCGTGGGGCGGG - Intronic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1043160223 8:76837660-76837682 AACAGTGCCTGGAATACAGTAGG - Intronic
1043919381 8:85963610-85963632 AATAGTGCCTGGCACAGAGTGGG + Intergenic
1048196027 8:132332450-132332472 ACTAGTGCTCGGGGTAGAGGTGG - Intronic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1052668290 9:31522338-31522360 AATAGTGTCTGGCATAGAGTAGG - Intergenic
1052992063 9:34524128-34524150 AATACTGCCCCGATTACAGTAGG - Intergenic
1053343214 9:37357072-37357094 AAAACTGCCAGGAGAAGAGTAGG - Exonic
1054943704 9:70771976-70771998 AATAGTGCCTGGAACATAGTAGG + Intronic
1057747182 9:97761710-97761732 AACAGTGCCCAGAGCATAGTAGG - Intergenic
1058959718 9:109981063-109981085 AATAGTGCCTGTTGTGGAGTAGG + Intronic
1060238940 9:121886757-121886779 AATAGTGCCTGGTGCACAGTAGG + Intronic
1061457671 9:130711201-130711223 AACAGTGCTCGGTGTAAAGTAGG + Intergenic
1062675389 9:137740190-137740212 AATAGTGCCAGGAGTGGAAATGG - Intronic
1189532063 X:41895387-41895409 TATAATGCCTGGAGTATAGTAGG - Intronic
1191967698 X:66778125-66778147 AATAGTGACAGGAGTTGAGAAGG + Intergenic
1192552122 X:72062825-72062847 AATAGTACCTGGAACAGAGTGGG + Intergenic
1197001447 X:121444154-121444176 AATAGTGCCTGGTGTATAATAGG + Intergenic
1197622376 X:128764929-128764951 AATAGTGCCCAGCACAGAGTAGG + Intergenic
1198637911 X:138720094-138720116 AATAGTGCCCGGAGTAGAGTTGG - Intronic
1199571729 X:149273321-149273343 AATAGTGCCCAGTGCATAGTTGG + Intergenic