ID: 1198638338

View in Genome Browser
Species Human (GRCh38)
Location X:138725614-138725636
Sequence CTGTACTTCTTCAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198638334_1198638338 5 Left 1198638334 X:138725586-138725608 CCAGCACCAGACATTATGAATTT 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1198638338 X:138725614-138725636 CTGTACTTCTTCAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 215
1198638335_1198638338 -1 Left 1198638335 X:138725592-138725614 CCAGACATTATGAATTTCAAGTC 0: 1
1: 0
2: 0
3: 14
4: 212
Right 1198638338 X:138725614-138725636 CTGTACTTCTTCAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198638338 Original CRISPR CTGTACTTCTTCAGGGAAGC TGG Intronic
900118789 1:1039949-1039971 TTGCACTTCTCCAGGGAAGCTGG + Intronic
901370228 1:8790890-8790912 CTTTACTTCTTTAGGGAGACAGG + Intronic
902198774 1:14818452-14818474 CTCTACTTCTTCAGGGACAAGGG + Intronic
902816080 1:18917547-18917569 CTGTCCCTCTGCCGGGAAGCAGG - Intronic
903983030 1:27203668-27203690 CTCTACTTTTTCAGGGGGGCTGG - Intergenic
908692909 1:66802913-66802935 CTGTTCTTCTGTAGGGAAGCTGG + Intergenic
911605352 1:99898644-99898666 ATATACTGATTCAGGGAAGCAGG + Intronic
912485264 1:110022084-110022106 TTTCACTTCTTCAGAGAAGCAGG + Exonic
915264072 1:154702652-154702674 TTGTCCTTCTTGAGTGAAGCTGG + Exonic
918042988 1:180924418-180924440 CTGTTCATCTTCAGGAAGGCAGG + Intronic
918244159 1:182644236-182644258 CTGTGCCTCTTGTGGGAAGCAGG + Intergenic
919808391 1:201394442-201394464 CTCTACTTCCTCAGGGGAGATGG + Intronic
919865682 1:201781222-201781244 TTGCCCTTCTTCAGGGAACCAGG - Exonic
921220483 1:212970186-212970208 CTGACCTTTTCCAGGGAAGCGGG - Intronic
923029248 1:230234256-230234278 CTGTGCTTCTGAAGGGAAGTTGG + Intronic
1063502922 10:6570971-6570993 TTGTACTTTCTCAGGGAAGCAGG + Intronic
1065875711 10:29995646-29995668 CAGAAATTCTTCAGGGAAGTAGG - Intergenic
1067291423 10:44946229-44946251 AGGTGCCTCTTCAGGGAAGCAGG - Intergenic
1068980560 10:63058269-63058291 CTGTATTTATTCAGGGAAATGGG + Intergenic
1071129083 10:82370531-82370553 CTATTCTTATTCAGGGATGCGGG + Intronic
1071445571 10:85743150-85743172 CTGTACTTTTTGCGGGCAGCTGG - Intronic
1071504676 10:86225492-86225514 GTGTATTTCTGCAGGGAAGGAGG + Intronic
1076306535 10:129469124-129469146 CTGTCCTTTTGCAGGGAAGAAGG + Intronic
1077519118 11:3020823-3020845 GTGTACTACTGCAGGGAACCTGG + Intronic
1079822581 11:25149277-25149299 CTGTACATCTGAAGGGATGCTGG - Intergenic
1080608539 11:33884801-33884823 ATATACTCCTTCTGGGAAGCTGG + Intronic
1082768083 11:57184332-57184354 CTGAGCTTCTTCAGAGCAGCAGG - Intronic
1084919868 11:72460265-72460287 CTGCAAGTGTTCAGGGAAGCGGG + Intergenic
1086599819 11:88619156-88619178 CTTTAATTCATCAGGGAAACTGG + Intronic
1087999526 11:104859486-104859508 ATGTACTTCCTCAGGTCAGCTGG - Intergenic
1088346563 11:108833583-108833605 TTTTACTTCTTCAGGGGGGCAGG + Intronic
1088909389 11:114179512-114179534 CTGTACTTCCTTATGTAAGCAGG + Intronic
1089460567 11:118650675-118650697 GTGTACATTTTCAGGGAAGGAGG - Intronic
1090266172 11:125354240-125354262 CTCCACATGTTCAGGGAAGCAGG + Intronic
1090700311 11:129289011-129289033 CTGTACATCTCCAGGGACCCAGG + Intergenic
1091722380 12:2822780-2822802 CTGTCCTTTTTCAGGGCAACGGG + Exonic
1093028316 12:14264855-14264877 CTGCACTTTTGCAGGGAAGGAGG + Intergenic
1097188514 12:57208569-57208591 CTGTCCTTCTACAGAGAAGCAGG - Intronic
1100737762 12:97556401-97556423 CTGTTCTCCTTCAGGGAACACGG - Intergenic
1100790349 12:98123455-98123477 CTGTGCTTCTCTAGGAAAGCAGG - Intergenic
1102109132 12:110351168-110351190 CTGCCCCTCTACAGGGAAGCAGG + Intergenic
1102356280 12:112238823-112238845 CTGTACTCCTTCAGGGTACAGGG + Intronic
1102787981 12:115619739-115619761 CTCTACTTCCTCAGGGACCCAGG + Intergenic
1103864979 12:124044464-124044486 CAGCACCTCTTCAGGCAAGCGGG + Intronic
1104192954 12:126501118-126501140 CTATACCTCTTCAGGGATGCTGG - Intergenic
1105213367 13:18270945-18270967 CTGTACGTATTCTGGGAAGCAGG - Intergenic
1106849171 13:33770473-33770495 CTGAACTGCTTCAGGGGAGGAGG - Intergenic
1108852599 13:54752098-54752120 CTGAACTTTTTCAGGGAAAAAGG - Intergenic
1110662056 13:78067924-78067946 CAGTGTTTCTTCAGGAAAGCAGG + Intergenic
1110904201 13:80864712-80864734 CAGTATTTCTTCAAGGAAGATGG - Intergenic
1111195027 13:84863694-84863716 CTTTACATCATGAGGGAAGCAGG - Intergenic
1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG + Intronic
1112362726 13:98731527-98731549 TTGGCCCTCTTCAGGGAAGCAGG + Intronic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1116013784 14:39382115-39382137 CTCTCCATCGTCAGGGAAGCAGG + Intronic
1116969843 14:51052551-51052573 CTGTGCTGCTTCAGGCAATCAGG - Intronic
1117133473 14:52708879-52708901 CTCTAATTCTTGAGGCAAGCAGG + Intronic
1117803503 14:59467388-59467410 CTGAACTTCATCAGGGGAGGAGG + Intronic
1118248217 14:64132753-64132775 CTGTACTTCTTCAAGAGAACAGG + Intronic
1118766390 14:68912357-68912379 CTCTACTTCTAGAGGGAAACAGG + Intronic
1119483654 14:74974940-74974962 CTGTATCTCTTCAGGGCTGCAGG + Intergenic
1120265155 14:82239340-82239362 CTGTACAGCTTCATGGATGCTGG + Intergenic
1123899629 15:24863328-24863350 CTGTCCTTCTTCTGTGCAGCTGG - Intronic
1123979103 15:25583066-25583088 AGCTACTTCTCCAGGGAAGCAGG - Intergenic
1125597392 15:40895569-40895591 CTATACTACTTCAGTTAAGCTGG + Intronic
1126447634 15:48766513-48766535 ATGACCTCCTTCAGGGAAGCTGG - Intronic
1126553390 15:49958468-49958490 CTATACTTTTTCATGGAAGAAGG + Intronic
1128221343 15:65970782-65970804 CTGAACTTCTTCTGGGAAGTTGG - Intronic
1131295861 15:91148601-91148623 CTGTGTTTCTTCAGGGAACCCGG - Intronic
1131962568 15:97805049-97805071 CTGTAAGGATTCAGGGAAGCTGG - Intergenic
1132397477 15:101484865-101484887 CTATTCTACTTCAGGGAAGGTGG + Intronic
1135391869 16:22100402-22100424 CTTTGCTTCTTCAGGGAGGAGGG + Exonic
1139061588 16:63259791-63259813 CTGTACTTTTTCTGGTTAGCAGG + Intergenic
1140657438 16:77155304-77155326 CTGGGGCTCTTCAGGGAAGCTGG + Intergenic
1141309127 16:82896131-82896153 CTATACTTCTACAGGGAAACAGG - Intronic
1143179007 17:4972833-4972855 CTGTAGTTCCTCAAGGCAGCGGG + Exonic
1146924518 17:36735044-36735066 CTGTTCTGCTGCAGGGAAGATGG - Intergenic
1147302341 17:39540046-39540068 CAGTACTTGGTCAAGGAAGCAGG + Intronic
1147778481 17:42921314-42921336 TTGCACTTCTTCAGAGAAGGTGG + Intergenic
1150047606 17:61928526-61928548 CGGCACTTCTTCTGGGAAGAGGG + Intergenic
1152128782 17:78463621-78463643 TTGTACTTTTTCAGGTATGCAGG - Intronic
1152891095 17:82882113-82882135 CTGCACTTCCTCGGAGAAGCTGG - Intronic
1152924804 17:83081931-83081953 CTGTGCTTCGTCAGGACAGCTGG - Intronic
1153264050 18:3250585-3250607 CTTTACTTTTTCAAGGAGGCTGG - Intronic
1153500025 18:5739278-5739300 CTGTACGTCTTCAGTGAAATTGG + Intergenic
1153980561 18:10305265-10305287 CTGTACTTTCTCATGGAAGAGGG - Intergenic
1155191862 18:23437548-23437570 CGGTACATCTCCAGGGAAACAGG - Intronic
1155920032 18:31594479-31594501 CTGCACTTCTCCAGGACAGCAGG - Intronic
1156580696 18:38371342-38371364 TTGAAGGTCTTCAGGGAAGCTGG + Intergenic
1157415451 18:47498655-47498677 TTCTACTTCTTCAGGGAGGTGGG - Intergenic
1165115041 19:33523472-33523494 CTGTTCTTCTTCCTGGAAACTGG - Intergenic
1168258820 19:55181524-55181546 CTCTCCTCCTTCAGGGAACCAGG + Exonic
925590395 2:5503426-5503448 ATGTTCTGCTTCAGGGAAGAAGG - Intergenic
930224662 2:48779944-48779966 CTGTACTTTTTCAAGAAAACAGG - Intergenic
930710202 2:54543549-54543571 CAGTCCTTCTCCTGGGAAGCAGG + Intronic
934300957 2:91775799-91775821 CTGCACGTGTTCTGGGAAGCGGG + Intergenic
935530433 2:104226173-104226195 CTGTACTTTTTCATGAAAGTAGG - Intergenic
936894270 2:117408861-117408883 CTGTACATCTCAAGGGAAGGGGG - Intergenic
936960355 2:118066923-118066945 CTGTATTTCTCCATGGTAGCTGG - Intergenic
939348599 2:141001601-141001623 CTGTCCATCTTTAGGTAAGCAGG + Intronic
939518667 2:143201821-143201843 CTGTACTTTTTTATTGAAGCAGG + Intronic
940584297 2:155625269-155625291 CTGTTCTTCCTCAGGGCAGAGGG - Intergenic
941604502 2:167580572-167580594 CTGCATTTCTTCAGGGAGGCTGG - Intergenic
941642134 2:167999849-167999871 CGCTACTTCTGCATGGAAGCAGG + Intronic
942983650 2:182112742-182112764 TTGTGCTTTTTCAGGGAAGGAGG - Intronic
944203993 2:197137853-197137875 TTGAACTCCTTCAGGCAAGCTGG - Intronic
944434320 2:199670952-199670974 GTGTACTTCTTCCGAGAAGCTGG - Intergenic
944661770 2:201927310-201927332 CTTTACTTCTTCATGTAGGCTGG - Intergenic
946028518 2:216687318-216687340 CTATATATCTTCAGGGAAGGAGG - Intronic
946502188 2:220261380-220261402 CTGAATTTTTTCAGAGAAGCTGG + Intergenic
947477783 2:230466676-230466698 AAGCAGTTCTTCAGGGAAGCAGG + Intronic
947584101 2:231341928-231341950 CTGTACTCATTCAGAGAACCCGG - Intronic
1168798108 20:625517-625539 CTGGAGTTCTTCATGGCAGCTGG - Intergenic
1168978438 20:1985336-1985358 ATTTATTCCTTCAGGGAAGCGGG + Intronic
1169182012 20:3577594-3577616 CTGAGCTTGTTCAGGGAAGTTGG + Intronic
1169811799 20:9616155-9616177 TTGTACTTCTACCTGGAAGCAGG + Intronic
1170523019 20:17207779-17207801 CTTGTCTTCTTAAGGGAAGCTGG + Intergenic
1171492365 20:25530154-25530176 CAGTGATTCTTCTGGGAAGCAGG - Intronic
1173469027 20:43308323-43308345 CTGAACTTCTTAAGGGGAGGAGG + Intergenic
1173803770 20:45911243-45911265 CTCTGCTGCTTCAGTGAAGCAGG - Exonic
1175462709 20:59165126-59165148 CTGTGCTTCCGCTGGGAAGCTGG + Intergenic
1175497887 20:59427285-59427307 CTGAACTCCTTCATGGAAGGTGG - Intergenic
1175503815 20:59468303-59468325 TTGAACTTCTGCAGGGAGGCAGG + Intergenic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1179481001 21:41678657-41678679 CTGGACTTCTCCAGGGCAGGCGG + Intergenic
1180816198 22:18791345-18791367 CTGCACGTATTCTGGGAAGCGGG - Intergenic
1181202387 22:21225677-21225699 CTGCACGTATTCTGGGAAGCGGG - Intronic
1181699319 22:24610937-24610959 CTGCACGTATTCTGGGAAGCGGG + Intronic
1183060867 22:35335654-35335676 CTGTCCTTCCTCTGGGGAGCAGG + Intronic
1184991363 22:48172310-48172332 CTATACTTCTTCTTGGAGGCTGG + Intergenic
1203224526 22_KI270731v1_random:69736-69758 CTGCACGTATTCTGGGAAGCGGG + Intergenic
1203266301 22_KI270734v1_random:17056-17078 CTGCACGTATTCTGGGAAGCGGG - Intergenic
949452146 3:4197549-4197571 CTGTTCTTTTCCAGAGAAGCAGG - Intronic
951366226 3:21786365-21786387 CAGTACTCCTTTAGGGAAGTCGG + Intronic
952710271 3:36424603-36424625 ATCTATTTCTTCAAGGAAGCTGG - Intronic
954221130 3:49154608-49154630 CTTTACTGCATTAGGGAAGCAGG - Intergenic
954441688 3:50525613-50525635 CTGGGCTGCTTCAGGGCAGCTGG + Intergenic
954895321 3:53970261-53970283 CTGGACTGCTCCAGGGAAGATGG - Intergenic
956119004 3:65947157-65947179 CTGTAGTTCTTCAAGGAAAGAGG + Intronic
956390306 3:68764950-68764972 CTCTGCTTTTTCAGGGATGCTGG - Intronic
956892145 3:73623854-73623876 CTGTACAGCTTCAGGGATTCTGG - Intronic
957243665 3:77691147-77691169 TCTTACTTCTTCAGGGAAGTTGG - Intergenic
957283779 3:78188751-78188773 CTCTACTTCATCAGGAAAGCTGG - Intergenic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
958915248 3:100042813-100042835 GAGTACTTCTTACGGGAAGCTGG + Intronic
960809045 3:121611038-121611060 CTTTTCTTCTTCTGTGAAGCAGG + Intronic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
962604596 3:137023188-137023210 CTGTTCTTTCTCAGGGAAGAAGG + Intergenic
962932242 3:140049159-140049181 CTGGCCCTCTTCAGGGATGCTGG - Intronic
964840284 3:160986163-160986185 CTCTATTTCTTCAAAGAAGCTGG - Intronic
966924796 3:184637260-184637282 CTGAACTGCGTCAGGAAAGCAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967375130 3:188792547-188792569 CTGCACTGCATCAGAGAAGCTGG - Intronic
968006783 3:195248467-195248489 GTGTTGTTGTTCAGGGAAGCGGG - Intronic
969620829 4:8278009-8278031 CTGCACAACTGCAGGGAAGCTGG + Intronic
970446677 4:16129014-16129036 CTCTACTTCTTGAAGAAAGCTGG - Intergenic
972850393 4:43042011-43042033 ATATACTAGTTCAGGGAAGCAGG + Intergenic
973632523 4:52832882-52832904 GTGAAATTCTCCAGGGAAGCAGG - Intergenic
974134641 4:57799681-57799703 GTGAACTTCTGCAGGGAATCAGG - Intergenic
975113305 4:70650738-70650760 CTGTGAGCCTTCAGGGAAGCTGG - Intronic
975394582 4:73859953-73859975 ATTTACTTCTTCACTGAAGCAGG + Intergenic
977985159 4:103374349-103374371 CTGTTCTACTTCAGCCAAGCTGG - Intergenic
982113316 4:152075778-152075800 CTGTCCCTGCTCAGGGAAGCAGG + Intergenic
985035513 4:185835851-185835873 TGGGACTTCTTCAGGGAAACAGG - Intronic
985982998 5:3488069-3488091 GTGTTCCTGTTCAGGGAAGCTGG - Intergenic
986017541 5:3770869-3770891 GTGCACTGCTTCTGGGAAGCTGG - Intergenic
986482000 5:8198854-8198876 CTGTATTTCTACAGAGAAGATGG + Intergenic
986599322 5:9455908-9455930 CCCTTCTTCTTCGGGGAAGCAGG + Intronic
993399071 5:87426587-87426609 CTCTACTTCTCCTGGGAAGTGGG - Intergenic
994750348 5:103729752-103729774 ATGTAGTTCTTCAAGGAAGCAGG - Intergenic
999128390 5:149264051-149264073 CTGTACATCTTCATGATAGCTGG + Intergenic
999321516 5:150618341-150618363 CTGTTCTTCCTCAGCGATGCAGG - Exonic
1002543211 5:179919966-179919988 CTGTTCTGCACCAGGGAAGCTGG - Intronic
1002703474 5:181143731-181143753 CCTTCCATCTTCAGGGAAGCAGG - Intergenic
1002819338 6:710522-710544 GTTTACTTCTTCAGGGAAAAGGG - Intergenic
1002885370 6:1289323-1289345 CTGTCCTGCTTTAGGGAAGATGG - Intergenic
1003238107 6:4316775-4316797 CAGTTCTTTTCCAGGGAAGCAGG + Intergenic
1004475351 6:15966374-15966396 CTGTCTTTTTTCAGGGAAACTGG - Intergenic
1006024743 6:31139627-31139649 ATGTCCTTCTTCAGGCATGCAGG + Exonic
1006657656 6:35609828-35609850 CTTTCCTTTTTCAGGGAAGTTGG + Intronic
1009663037 6:66638267-66638289 CTGTCCTTCTTCCGGGATCCAGG + Intergenic
1009933283 6:70202611-70202633 CTGTGCTTATTCTGAGAAGCCGG + Intronic
1010733307 6:79413279-79413301 CTGTTCTTATTCAGGGCTGCGGG + Intergenic
1011385169 6:86788669-86788691 ATGTCCTACTTCAGGGAAGAAGG + Intergenic
1011823570 6:91280585-91280607 ATGTGGTTCTTCAGGGAGGCTGG + Intergenic
1013469851 6:110453457-110453479 CTGTACTGTTTAAGGGATGCTGG + Intronic
1013605667 6:111745306-111745328 ATGTGTTTCTTCAGGCAAGCAGG - Intronic
1016899514 6:149087724-149087746 ATGTACTTCTTTTGGGAAGGGGG + Intergenic
1017845654 6:158255843-158255865 CTGTACTTCTTCATGCAATGAGG - Intronic
1018556431 6:165055693-165055715 CTGTCCCACTTAAGGGAAGCAGG + Intergenic
1019611735 7:1940181-1940203 CTGTGCTTCTCCTGGGAAGGAGG + Intronic
1021332229 7:19352811-19352833 GTGTACTTCTTTAGTGACGCTGG - Intergenic
1025733280 7:64125225-64125247 CTGTCATTATTCAGGGAAGAGGG + Intronic
1025935282 7:66030989-66031011 ACGTAGTACTTCAGGGAAGCTGG - Intergenic
1027112604 7:75452821-75452843 CTCCACCTCTTCAGGGAAGAGGG - Intronic
1027284850 7:76637427-76637449 CTCCACCTCTTCAGGGAAGAGGG - Intergenic
1027486386 7:78766793-78766815 ATGCACTTCTTCTGGAAAGCAGG + Intronic
1028598961 7:92580054-92580076 CTGTTTTCCTTCTGGGAAGCTGG + Intronic
1030627952 7:111864416-111864438 CTGTACCTAGTCAGGGAAGGAGG + Intronic
1031426363 7:121610361-121610383 ATGTACTTCATTAGGCAAGCTGG - Intergenic
1035956525 8:4086688-4086710 CTGAACTTCTTCAGGTACCCAGG + Intronic
1036637203 8:10559545-10559567 CTCTAATTCTGCTGGGAAGCTGG - Intergenic
1038059293 8:23894487-23894509 TTGTACTTCTTCAGTCAAGTTGG - Intergenic
1038957391 8:32482550-32482572 TTGGACAGCTTCAGGGAAGCAGG - Intronic
1039225134 8:35379920-35379942 CAGTACTTCATTATGGAAGCAGG - Intronic
1042809021 8:72803803-72803825 CTGTGCTTCTTCTGGGCTGCTGG + Intronic
1045068031 8:98469577-98469599 CTTTACATCTACTGGGAAGCCGG + Intronic
1047054349 8:121147498-121147520 GAGAAATTCTTCAGGGAAGCAGG - Intergenic
1051229551 9:14941372-14941394 ATATACTTTTTCAGGGAGGCAGG - Intergenic
1051433639 9:17007011-17007033 CTGGACTTCATAAGGGAGGCAGG + Intergenic
1056198507 9:84251795-84251817 ATATACTTTTTCAGGGAAGGGGG - Intergenic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1057629619 9:96708715-96708737 ATATTCTTCTTCAGTGAAGCAGG - Intergenic
1060854798 9:126906818-126906840 GGGTACTTGATCAGGGAAGCTGG - Intergenic
1060969921 9:127732091-127732113 CTGCTCGTCTTCAGGGAAGAAGG + Exonic
1061671255 9:132189557-132189579 ATGTCCTGCTTCAGGGAAGAAGG + Intronic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1189635879 X:43008641-43008663 CTGGCCTGCTTCAGGGAAGAAGG + Intergenic
1193391307 X:80931873-80931895 ATGAACTCCTTCAGGGAGGCTGG + Intergenic
1193663212 X:84282258-84282280 GTGTAATATTTCAGGGAAGCAGG + Intergenic
1194023883 X:88726880-88726902 CTGAAGTTGTTCAGGGCAGCAGG + Intergenic
1194746310 X:97632249-97632271 CTGTGTTTCTTCCAGGAAGCTGG - Intergenic
1195907897 X:109863564-109863586 TAGAACTTCTTCAGGGAAGTAGG - Intergenic
1198638338 X:138725614-138725636 CTGTACTTCTTCAGGGAAGCTGG + Intronic
1198701976 X:139406588-139406610 CTGAACTTCTTAAGTGAAGCTGG - Intergenic
1200988619 Y:9327901-9327923 CAGTACTTCTCCAGGGAGGGAGG + Intergenic
1201474470 Y:14365496-14365518 CTGTACCTCCTCAGGCAAGCAGG + Intergenic
1202119371 Y:21508291-21508313 CAGTACTTCTCCAGGGAGGGAGG - Intergenic
1202121823 Y:21531831-21531853 CAGTACTTCTCCAGGGAGGGAGG - Intronic
1202157183 Y:21897551-21897573 CAGTACTTCTCCAGGGAGGGAGG + Intronic
1202159629 Y:21921092-21921114 CAGTACTTCTCCAGGGAGGGAGG + Intergenic
1202186076 Y:22186007-22186029 CAGTACTTCTCCAGGGAGGGAGG + Intergenic
1202196735 Y:22305687-22305709 CAGTACTTCTCCAGGGAGGGAGG - Intergenic
1202205283 Y:22400389-22400411 CAGTACTTCTCCAGGGAGGGAGG - Intronic